Strict Standards: Only variables should be passed by reference in /home/biome362/public_html/download.php on line 4

Warning: Cannot modify header information - headers already sent by (output started at /home/biome362/public_html/download.php:4) in /home/biome362/public_html/download.php on line 5

Warning: Cannot modify header information - headers already sent by (output started at /home/biome362/public_html/download.php:4) in /home/biome362/public_html/download.php on line 6

Warning: Cannot modify header information - headers already sent by (output started at /home/biome362/public_html/download.php:4) in /home/biome362/public_html/download.php on line 7
%PDF-1.7 % 1 0 obj <>/Metadata 96 0 R/ViewerPreferences 97 0 R>> endobj 2 0 obj <> endobj 3 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/Annots[ 24 0 R] /MediaBox[ 0 0 595.32 841.92] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream xZKoF K2zI0Vd% 8+i`@Pcf5CC5`x=iHFD]]UUuW&Ge_ӊ=>9t1ⷛl&˴ʋC~YVxO^yO{ x?FR3h.C+?g0< YŚ !.&?.yI~jIiǑ9Cj/`+bW{l&M$Q.E@lSx0#.U@UU,c(&r~X<r#dצ U)c,O#/*8_|CȪ%M^+x/t+N]g(:xdC Bv 냁Dp"^QPR:ች2:ߜ: Ϝ2wR_S_N.d  ;O;J V*Q5 1A•pIzE ׵5RUvje>\őkJ% 8I9wWx:>ڻEh;c55w< -@(g[ :9GG-3 PKJm"lt_]Jx0 )U53'}KO{hFyYo$( *9@}KB|x8ZbP7fZ!iI^`|+Zv"U0TʶXAe3䌔G1)0޷VWkVHmʺECN 7DQWhjq"theM9j_jmAY U Jfv ߕM:ba-9!Phȭ38QAhSW?0U=Dt֩ =Brϳ/]L]F] ~Xv`1 PxmJ&'t9MlhVd3wM t2o#V{B2}Bz$un z ܁s Fu^{3*S:+2 pHkځ8w 5P?]6Xr\{تEiWw5Arѱ4RW#qh} À Ѕ9Q9];,>*Dy9ܤ-0HMa:zٓDI!3vd>m8l[&5d0xȇMӱV)}`a'.YJuT!bhDonI`XӍZxMo0|+Z;g|654Wx\#I-4YY~:`3^;B#uA꠮}_hՎz?x=IxIqgH!dZPdvX"T\ 8<ϲE Z!ko+} m ) lnl共k;tqkhlGkXگ XyPI8*S;˩ï=;HRZ; {90 mxm> zZc1rLEBГ[ ' bV?c2!]7 =)ffINJF b!Kq"%;BZPOꉒaR'vi ^Lj1"vaBO#TկOD%h"iPB*\zk5`ٔ<*ν_h3!A.ӿu|mп& endstream endobj 5 0 obj <> stream JFIF``:ExifMM*QQQC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222o" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(*{;;B-!yQIji6H#rN2? / ss63u?S}k*inTPW!rP\ft_ u5[!դ}LuARun݇X|ҹ,x2يj"Uy]t^OZ=fZÒ>?Z#;sZo_D-ŝ?pG^xxvzD/f~S=T+I5h iqߊ\>&^J_yIN}/md&{ksƨW:}]̇ 0jw,(`QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEZӴV++8Jp}w5e1]8rO«iB?Ӯ3ds_ճ?MY}Fp~nOdzwb*ck}V_1sv[:ַZ^k3g>e=y*kk9?4cau?r:{j=ħ,A=*XX ^[rK19$Vbj WCi]Eo nFuWПĊC߰.[K` `{_Az,&#$rݛgIQGcWs:OzG\ 5d:dQE}8ޡ"B1솼Lާwfu:=jjwrM%I״b=q]FIyu &$`+ 8bq,q>*|qd~g~uɏ go^i:QGmi0>y' EWtǁVtFӸp?ag,O/R+#F^^}gU=*գJ-ҵ7Z}:g3!H rZ OJehZ+͓+>}6ZW"H*uyhMW- u+65HCұGCo42Y-ƩK!)V@3tךk6Kk0o)댜Wx%]ztӯcݏ,q\;Iz*޴"zP 7 #C;r=h 2` זl >8g+5 hkug>JɽwH==;P?Et-5_(tKlnc 5nKeZG taT1PF9<`'EvOi#JUI=qt=zV|Zd2hRBUJWi cLsh@g,mٖY ] ҸK Rc%RHcfLqB(S91 ]m<_8W]WzM̱5̄s7ET_egSkX]$֑(u w Dg',#8/k̯-ޓ!-οּgWn+nn-g n3WI{ R͏QsSSL1hOUDRȬYjF!u,A?׵% #ΛYc5&|5UNVG#k7ɥ!UYQFY5f \f@,NKmN } - 8&6]Zj~ ;iYmHאH]KvN~)yU*J{spk*O/6l~f\F*mMʮ|[,9Ll"~[[}:xC``S5((@e[9ijG<^-83SA_}i_tX-<&}s?c +W@MM3Tid zצk{ijYC"O3aTsޤ))a&IA+mh"8^pSUYYU($ǭ6,+~ ᦿm?G(n!Vݾc7uܼ qYՄjA{15ufl|P_MJ5>M/?r#:ŭ?-Uv?㪟l5QA-΅%W6 R=(1EfwOi'/Sh,;=ǥu63լUǫYYSxV[jRzlb3\x0꣎׭4xZ|nR9 qJÖvS4G 呟~qT.UԫѿR#<{/o9 MCXCMV>qq\`7[oݿc}R9mVY> BBW'א?H@oqS_̂R/E]1P v|cۡ?jW۩ VMPD{;KR+]sAyrӅf>U֥zX5CyVzoæxzu,wbhXCʙ=Zk'TPOǧ\W'H%ڼQ4`mc\d[˹m#HՉɨէ(.YX+Jm"(<:'bMpSVmtsOۋErJˋXKJ@`I\ z˻{f) ȯ(UkCq $27mһ'sA/.vL-&x~IVݾkuhH0aMMLng@Ԝ5݌>k 4 &6?CRKezZ;yXkMVy|+pdy?3su3/wg }mjecEQ=qG?IqA JeMT5,z5wqkpυXl{ 1Νr Ȳ40T9O;wx ON܏_xY1f3qOҩf\KulR$gFM͹Lm/R MsYcC!B׏jrIp.`N Ʃ bwyLZnmm0VPXO{;:I [ȷ( f<ց&ʏ\GndYl%(wlsU6 ?Kǥn4̐ڴ!#(GUoA~.-pA?$G8->!E)3O[Hu<N4Jo.H#ԺYKt$KF\19W5,%ě0ѐ>GwM4)ōiZd`1!Xx ܆[]=,C4d^?&^ObO&pp3O܍42rOB:Ml99§c)qVaSȸUIS8?_uVjT%Z봗 jG.؈>1Me(l݃75Z궷ʢH2?QR\.e)u OqsoiזU^5b_48[N~緦?.\<;|I#:H+7S#>3,SHh\~Ou?ڰ%neN7zm#]/;U[ oqm$$kzXQ [Uy/㲷h-d ָlym?TNEK_ٯ J+[嵶~zj)wb\2J_4B9c֯O OjYnQit:MZ9f,r_YEBG8YuN?EYխ3{luO\tu'羼̒HXa9b?̊qm2Q^QEQEQEQEQEQEQEQEQEQEQEQEQEQEQE%֗1\ME}mcY"k9I]CzWt̎) QRjGjM&n`7/Bln_͠a@f?7 e J}lڷJ34~{^k 7`B[q~?GZ꬇GPk^ o]oH|YG:kIŦu3W\PzúJc1zl<$tiEmp0#8I=~=+BHf(3݄q!c*ր.ݮyy\([ݣ]IKF\qoj:*M^N?sm`>(h D5\GE}x_kZ̗7R0s篫c.-ė)Pe FN$GaXQ^QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEU+:.f>쐹F #wMoF8|pk+y^N7I3lQS(F_Osѭ&U0W>_ GtGM%SEWǞsמ6IӴ.3<ߙZ>]GʯtV$2`QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE endstream endobj 6 0 obj <> stream xTTg.,l,,KJ]EP@TDD"6%nb4vQGQ-4VDayP0s>Gy37{;ehvivi;afήaaa"&k{rܵ]u^,߻u뗃Isu{boۺU3L)m]PY=GOa̒˓U>eB)S`#y~ȱO u,?c˥>Kj/ ;jWӆx~[OmӪ2h#|ҫ2<^Ѯ?K(.k CC.Ag0jjzF1=WxwUžd2Bj&Dd2_~V{&?#d,MC!jee6!ʈ84㗇;yۺˆ|qj$ME!le* D3D /7;Ӆ*)P[Ц%vcsU=$m |55>r qA,J8aoI$6m,/n mpҦalU)454 q6MQM5:FܛJ$v[E6ٗ&LmHUT!l NVf1!o y׫{=MެqNQ)zҬkƍ5 <[[WO|@_WGK;AQȼC⿶:Q 9q4mmݴQ:?R}?IHƴ)\ "BijT"MOQ iӆ}B TM$Xq#hih M,@Oh@QUF%M^h1.ΎvBC]5G)Q63v{PA+s2Ӎ$QthDNKrotwq231ԓDbeJb|czWhe2Zʒä olji_aa`/w{kslp yޝ'X4.lvo﷒%KU kmjitKTrHHWK;lLd{,r5Sr[7R,*O] v;+Ãm-L ujΧTevO r01ѐXbf}-U%v[!RT%B [إ/>-~5/{blTл*D=I-Ƨed7D@UX޽h$#KL5RdշTzBoBڠ_7K/TytJl._SPdS݂*AjHQAX}hJyr34lAƠ z Y%s Y"l(712BA[V ;mʯEh#R98*q h>LMGo#=:Of9-Rm~"%B,V]CS+wާ[->?oZ_h} Vbѥμl|[KMn*!Tإ4x8'#sd+5X8T :HBBnE |ЃY1"\N=)'=‡|i&Fガ 8oqI]n=yy&wVyй$ 4-x̽`jxl"K عp&w'Y%RiPh@g41:2&<ƀNb͌@8vshŷ'![s|X{-Խ ' %OHZC~O:ٖܬqţOEI12lnJvdW˔CVnaFD7fӤaұTCs0F*?("/O``CV+CoeϴLO{ٌptFϥ )"%%LnBF&ovxzyr?'T YVƸ5~m48nK9lt?+^}j2p=i LПw} Vg8x*@i ,%ѣ_R$[E'iDO_lVv^3юGv+j!jq[exsZtsrDҹ=?|Q(/cSfe9^Pnfa0RvQ46u~Gx*;3rFԛ`a:80O2Uz|9>{2 P`] sl ߦ|@tl{&pJoox'w-3 ]Voei7EAs`IL*d&Dz9p#_ dբYL: (go9q@Q$p[Uxƭqn&2V/uېWŸ)iHL?LMXuA!nz!W8󀸩c)\s;zGL'["W0_w{K -,n,g-ɋg(xU)>'zHqs0+&ع?=Jz/]z69CJncLRYǘ"s.B\NN%<CT; n_ͼV¸S; ÖV˫B&%F'8B[,9oZB{#[۶>w$#z)`cuwez30VXz7'`e.ݚw P[ Uq Ma2ܩ+FM:yjP>ۮ{ `Dsڴ)eY;B`浢LZ܄Mh wæŇ\y.ѽ1o ǻ)pn52Dtk(TBJq !ܸAep¸ 2YD VF)ݪkhOeREI#}qsra[) ~"MsJRܖ pέkl4w?bqMQ{%[{T ܪŔ,P0^qWASKcc64 sJy Oi[+4u>~(F6 ȷ!sa&!!?+p; ̝KhDvdNaZL+UYWmg[NjXDnJw!/$h^+aQ VMZM7ugr\-tM 8SE:*@Jdᯡg10mgY:艀P]FМ 4,yvzf$]P3-샃Hjj!̅ @Rw4PQeA8.dmZslE,P-UEjpu*fh&2"4]Z9O}nI,t(bSbA}w tB[PEYh[ؒ065.A%WMKOhauU/ٽbkik.qu$ QRdI@@Sk'esJ+OJpD%'<^|ba- 4.N_?qʬE_пG /'SCI.n)Q>ۿ.ϼRD>PzG /B[0.1&6AERE^Ze/BlgĻ5)%JHbA"=6dr#bB7{ [D#tQ ]Z1^q!@6iI /^1~8n{Zs$%zA oʪd>qVOgoQ!dTIhƸ|f, XӁ1mm'l@jbvB⦳E{&Fy;Y 8E`܅kKU|csr/c؁ ;w ɩ^f*NRF95Ak&ڈ\Ԇvי}4{?*s6qE.2˛JJ\[2Az*Ս>28 1c$+&m.T|ߢKoiϡAv~x>IZ7Hc=5nnsO\ q/P^Ѕ[wlۢڍd{ҘM,,K_ŕ23q_;OJ|/XĢSk-.9F 1Onڏ|s\dSmjдiƅT^ 5LtljnF'G[)qvǿ@/5ߙ.^ "{=D /eRLml1KCARSC@iz0Ҕ@Gfh|K[$"#GuVpnCS|1-o8V"GXHb-HuD*OKM,.p\{/,3AfvԋK*Wwv,,1BCԕpu4ɯZD$G!.5 c(1*۾NNju}Ù!u B&ўYM?׉9yA>ʃ+h|vݷ0W5;z-47nf#oXIdbpAX݃XЩX.-_@-3MigYgP&.+_xtO5a$Yu|Ò=Pҭ[hiNR|cEyyHƆsXזj"n߲l.4ǃor 2veO,^~勦ҁhmKSuW'Z`<|y8 C?cօʷo}.:n}Enᝮ}1w3eh%'LZ QFçQ9Z|eh |U"0F2F< t:X|-.1mEA|^э*( -!xZ|U3xnLY¼J<(7Ņ9`+)"tvl+ijl:Cfy0qk(5W0}&$v8ƒFZ?4$4М'd軔N-~#Ylj5>]p쉲㘀:А453{Bk/jvQ<2z:f#*R!{S&:LK[ w"%N@i8֋1s,۬evXM]V[ $f+}]Tn$ fl\sހvi#|=oo3{ dYoڴ?YR8sLx߁Y$LGoPn |ytk 篙h pyc9Ag7O;_šΗ^ieډy"VM_ u=`Vk4 ;Ҁ(z, @zR"7!nd|s նa ' rO_n|;OIGjX00n{U`?L6w?7iI3ܱ7 Q*KbJ+|ʲ.[g?Ht| H+=sfQu_A .{[ 渑 ܠ9np Y\.BJoX} Y /=@ n6l<%YBoL*JnI'R?Sb~-- uG#%`ZKi 2XCt5%DmXy@R]x-I<ܪp=|FW'nF؏3u~tpdY;{$OJKώmphc2>=u/l_hoΨ߈ugFon_!zI=mq ^:?5 ܷUA#zzdl[`I43z}'c-=>KlaJ&1@ /^k(ifw'Rw ۽3Q zӥV~iE50z2R&̀N.U׀5 O``@xuyR&vq1n7v;Ug ]S_y0"L Kд'v K m_Cop# )H"%mЫR"MgJG*`ecoq{taݭ|e.{6읤Pd,h& -^vGĻxUXW&twpSzvlU<8dL֖fL G̞ܙ  R-Ry(zEq+ ú`Kix@ ‘ުxkиnY92hP(܍⯱՝&~?_iyg&plc3}  HCKmɖXʏo7j[:޹zRvz!E)VӒS6q '?{V_9wR\t/nK?V?ێ@W9vl) 0G%*WGO))뛖4u˗IAƥ*ݨyoM":vK?gn5gyD劏6t@4y$ 3w)OБ㿯;ЊL]0.1a)|Y$w.PV5c4'(">1OYW 7X'9B\/Iqi9%um}K;'wШ,`VT744655564TUf'Gy|/8G[%耑^zjZzF1ɩٹE%e PZZRTL^ j]pdGl#mD{Phdt\BRJZzfVVVvv6LOKIN  q,02D|c%e5-]CS {g7Oظ ^emQ'5"۝*z&Vvή^>~!a 5az ?@O mL '=5t ,m]=<} 9b¡'?ֈ6:i# TgG[X;8::tc;F2F0P9!=*+4&%y!,E4i4 mB6Wwڶ} Vرxֵ^$~}]Xhh b*=ra<VbX o}dϣEڠfMHx3E"u8%H=grZMYSh` `͢Z{A]Z"o?aü`%ĂأM@8 k{؂pY~HX& 9b1˴څӛVI!3<]5a~a endstream endobj 7 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj [ 15 0 R] endobj 15 0 obj <> endobj 16 0 obj <> endobj 17 0 obj <> endobj 18 0 obj <> endobj 19 0 obj <> endobj 20 0 obj <> stream xZwTT֝(JSATiX@P "Mz/bG@c. (E1KL,[y{qfXߞfMYŚs޳gmؔ)Sf͚NR _/3yF6;2c_fwhewv^S8~ٳjgf^b** JGG5[jnҙ3g1qqqk;fS _֫TޫW@Ny\O m@B-w;iOWW5Sk.'UU JI9jN)U۫X}@ #G ͛Op",p V|(Yi P wwu-^+}WEY N@S^yQ8` `gP/8lhhhgUקg>)\Ygmmmff>w\?uBŧ,V*[%%Eݱ#!zǦE3tLX/WnU"4UPĴ,FFF>%O" #A@( "t֬Ych]ggouӯ[M ;wg[C wg 8F`H ⶑsϐȏWXh" B'| d 8(iupZ dYX2 &CЌ(QQ枞89{^ۮ=/=O{79B*PL("P D*((޶hF ~fJy< dt''G+3K7"sV29!,Y$Bb|ZOFk{R8Kިf5y^^^mm͛G‚MPJF/EW^X"jf׵M[iCA[ 6$3&#WIQ~~~n("*VtKwDTMm-VҫWiD! 42#ˆs;Xd]=wSx > ko/+lXj Aߪ"C6+GL'6ӪOMSf"+Wo?{`EGnJzzz $$xro{{SSSt"uퟢbx^ lL,Oevw}qw4{j&GYm==@*}3|x SBDmU֭<#mby+ZێND68N8?2zM,D6:S9>WJcj`*NܾAh۲ƾiODT7###eof-?|DRv őh .DK$rȥD|HAv&"H v.]W cjǾ?1AI{OqU}GLVC9 `3yS_u 8(!!hC&H\pAy8NT3BD44[ f3!7Y7cϳ#_h~r9RR95S,Ϋ}Sk$ߔ%ƽB.̊F ڨ NDWЃJNpwh# Q cF;;U˄pA5c4? AFt}$ϞLIG&sI.2͵"8d^@ ˖-#*X nHO'Ȃ^mh L#DBmwwl̻>4vU˚L\f/Xtؿ*#=2Nf";ٺW%u^*6f+90|F/ A7>|]N}||J 1IJm&3L]`v 3lث/ G:{߸,N#VR=e黏ɨzu1t؏5UKi=1pJcW c47Q7KqIݝc"M#N'Z'^fouE=Lv|P49eg>q^3ǝbMG$yoK1 UAg R,qv$`y,$C+wk n%WAqh&k\_T<h {5V],9{ 5?x@kRY.qiXwHָr. \sz&̃aB@7XMy6 ;qTq/j`p>GT8HkVSSp.K?y~OV%M?jl)6a5G%+*:l1l?m8|{Esb_jG`BC5dgc;vHkB}p 48S$Y2p&'ő9k>"f&{Y3FqT6Mq(Pqה̚YZYtZb:;cb,flE5q"5@Tp<|k˃{tAJ*0^( 5rdWʬwxoϝU[9#B^Yqh%A-\[j{Bԝsshtt=_zC z6ޓ 8lZMɢk;,)^GQdjpf%Zt6sV֮=ӬuԳE,݅Gŋ{{{Yrz,capP׺N+K4Q 94"-LA5x*1󩜚YӲSXz:¯Ϣ2 s *.&ng5HJ ۼrJ4k hN[û IIݽ:@;; ]eRL؀`6p36 p>ƶy iss(t] PQ0WWhPshsy53yB I ]-Z6-[EI,2}FL u8p`v Odl) V)yhk3XaoCQπjiFxE3yFݣLzA>ŨRzdFQy ye;.q7d3S*N*?\x)|29'*2OsS~ 5k} ]9\j~EJ6myֽʊj틵TsuuT,LHعq&\xcfnzL6t z/BXjjjFiTT"4͛i;׋K. ]0X+喣 kޓk,.0 fQmg!ٌ=*Qʳ凧bdqf5޵>|=R )))[q;\ZߨpN?61á\,0ζmM^OcJ xz%z *G+up̧*f0 552NE*|"*5L57ɵOOߍYN Lh2kdiGv뗚O'7Ϗ_cggwxclQr)ڧ]Xݡ|w&ǜY{hYe>ûXMU7;LzX%Qjߙ{۶!ظNM!/y=ciLݻw? h͐{k0bO'&U GA+ִz{~VYiKi>V:\ŽԬ*&+kWƀիWCd\\Y+ZL 7R27b! mk;3QǶʶ -@BB .9y8EJNJS^\_2J R[3g΁CZ^~0noYVV&'%5-..ہAA3g5',dרbx5t$,۷ ~t5}L;|/ FwD܀A(4d ])p2Y@k8t{tO/i[v6Ͷ7ROn @~ܽI% )ue@a[Q(mVl6cH _nH;Hd^<8!uj3)(NPJu: UaNL;b(TB|C0^EB@^^^HkL:S[-v̇7KE?o7#G_zЗ@A%T[Ƥ:8aӍqLa8BQY?90h]zQ$aY IjYlI?lpip`0\_>>׮]_}vϕԓ A?ԲZjG&]iC]7FO}Y͛7%@&\fs=ח?-1ck?A5Ջgϟ?={*1g/2BX澾/_zk?|rmgrs CJJ@#`bmBDt_'[} endstream endobj 21 0 obj <> stream xipSӓd%yY, ȒW81AqbhB) -LNC;%iBIЦz2Y(#d#{ߓ- As7?^݇a<"*.>VX^.FqC XlO D>W9O$}DxNp2"xBI\$">qs~c0ԷH*C _,K~7AK\6W/Džd:1^MRFI8ߋ %`0O" &dD4/e1fjI uX,8d'bg01lH[g󿣵<;)٠rE0sTdJthri+(A(o?ϛA` 1Nw&^X6G IA0OO&;PLz~Eډr0K+ ςo4u>sU)O?O\۪L>%i/p }b<}q:~<'U- ܇aqruZ^%05J`J~ w1whiD2/gbyJ4<+DvǢ/B'0񸲡;C0@Ý/D ]] i6e+R\ -BdܪyF-lx&_8$鋶`[AF*B AZLɭ`)AwMBN!"qv ~QcJWYI_XGIbso D\hcd>[ @ܛ*ruqRUD%ec5ePЌc F<]%Df s"s16NyRej~kkZ5"k3} $>$,9X 5L{_A_D}I7,ZGM^ tVD= 8xC2m `ZSJ{Џ ; V2<ý^WS뱐/Y1?2ю*,OZ .<띶Tݩ42;N!9{VK]MF h`Kcx]lwmٲވ`L#O]q8ȭmJ Ihm 39N3ٺroy9ӆ?)+Zoڹy՚c/ZWO{s0gÃp_M(wooegi2[Ͻv0-eHpƥM]Vӗh= c|&w̶'Rt Ş7^i)'q`#{Ts֒zu۹{*W45X'` K2sۻvME޺ޱ*&t#*h!&9=ֺbM߶]{!Đdڌ\K~… lի|?DH1$xw1=&kiR^hsgmr3ПdE;.QXW+;k3Kh`HDG숙"+wpݻ||o$^@@dObD%L1QC endstream endobj 22 0 obj <> endobj 23 0 obj <> endobj 24 0 obj <>/F 4/A<>/StructParent 1>> endobj 25 0 obj <> endobj 26 0 obj [ 27 0 R] endobj 27 0 obj <> endobj 28 0 obj <> endobj 29 0 obj <> endobj 30 0 obj <> stream x_1E)';;V7}SYi*R J~7i[4D48D|ikfvvwvgfqͭ23Ͻ׼  D bX; 'Oɮ]8q֢"#'dcҤISLP_)++3bQ?廌\&LPWW"/ED{Z2=I}U M,Sm挤`q!WVV&!}`Gr:z"rXNCFGvBk9f$cRMFQFK,ed+Kɷ2f,?_@0kیd).2x#;ub}sqk`_8e$j@ $hiK%%A!ǏKIJͩW@hq$V#5RCsqi}.#魳͹h'}Beǩcˊl "D=,$#qZLo5K04?\9[/r摍x+0s@z/}@Im$"pDL1/'PqH$ "ps%|د[諿BȑEr( zݾsgU~izÎ nY^ nݾ?#g6_#4[]yF'zz|~  $~XiϷٖ諾]\sJzA?ȳxVN*p2ႂX,$گ>%EmiKpf{?3 6|NV}ɓdk.n'NpEEE#O8LJOzL2妁} l}c_ec;1 Y $E.\鼒GI&M2eJYYsHwP_4r0aB]]]{nIAn$_QWwaI'ƽ}NێW5KdHXgВ=/FࢨKh$Qg޽NE˃HWՓd+=8& })@N)AK{̃vUw9 }5FHm^Is+%ВAs|)_(~*++T>#9JEd{!##WIQG!9$q9$Sq6!&.kW[L>wT 5{OwIRX -Ms#OȦG,bQj`G^f=YHMO[|5~ۋ,@E}Zɒ^Ky7־<5#{[^gJ5?i _xg5k߶<|eWOn6-VRK*"wN%5vOWI45z&<yȯ~$3|\`LY~VF3~Z@)^!]ܴoA} >N POSv2))b9~<9 BSIC{N6'~#ǫ V)٘D5FR*_ z{CCm%׭Oæ%yΛM\{@]2J5Œ C$ Yi %伩R*{_%#램FD>5Twa>rNjƺ%XTkEL#s@YP=szj1r\b~֮*^F1):  l)$9/]l9.[3k:W7BwI$}dI$> n͝}C9U>zrۃQ-N,[kWU R1,R9o1 dnrA,S>Um},a4zx\z<1 @O.pIcf_ۓzp9 =| i|k1VQL/П Yn1i, U?<3ـW_5pK1gՋ5l$>&r=.ߨ)Λ+U16jB˔4 'paI҃}MgR{p9% `\Y 31 wd Hj;{jgj.qΙBcpbl)) &H1A":MsFMnQE2.sSnݾ*k $)P1I]f0ǖ n9(kU+)DD(BL#?$Yb%闹Iދ0N16 $i5&yݚͲLlsDRzP6njgٖԾ}[jvzT~tAn"qXb @I<MEjVwa>luȒ<cQbl $i-)ޒz፿; r1 @d{K~7=B[lSz@ȹ$9^gyk3 EmrowzIJ9 _[.rIԽf̉h_%|2"ދC(@$ٶT<dsgXYx/]bl Bcc>$ooxk~W8)Qض3)r9&Im$ [Rз1Kƨl,}y\bpf<^_0 {KʡF/x}N|<ݱc1v=%X6  bw$|-ߥ\Q.{[6\Ru= cREݲɓ'd׮]N8a{kYYN8' {KJ/r7UY"f-kLX<4iҔ)SW$W1(s Y!c0J}PՄ lQ|-yc>]U1S16w\el$h $ER"YH޽{F$eypPco#g6XbD}R9ح]U|fr{LRIn "/IX,\2)RGߖ!)|)񫷤}Nb{/B3$J+Z97Mka2dG3f,w=#N;oypV%&}>>˓zoM/"Z W}͏{8JSTk9z*D>cL0k.j3n8R o~htKLRx?}r,պwWJpS\W_<9 Ѧ %GYv@.S1IQo9|BuSbr\2]W\2RHj|-YXl9mZa{1gՋ(hte~q@Tlc4e钤~[(_%Ŗіֵ.^2A6o $EVۖmc>T~}ǼLqI{j[{,ƖO|>.%5K/K~{4v1govd)l-y}̽JTL$_'LΚ;+/Xة'\yd^A,vBt_%&ɧ<:cKﵟ_H\s/~ӳ(pitH1blYY_'rs 1)C$#Z[RF&\[1oZ J|>v8}'&eZd6r%&5[yHZI>q\erQG*Ac1S6}z9C\WNF5K:-Itf),pYy̆%F7||o9IJrdΛ5)S]5x|km}L*]Uuwb]T/l,GީHr`s̆ԂbFɔn-rv/%a9+y X6~I$ݵ-'P9__0:ZoNg+.MrNչk wOVRP >ISNcVwϤrzʼG¥=nitȲIl,nZݗKEcUL}x&Q*Z.*Tѷ^%:W? J$>m},Tx9$sLrh;#颵*rh25w mK$AW$1I#te[K]QD- uN>Y~eDչdIYX.󹠟$K~]*i99p-)Id%#}}f$ZIN|.'UIլ;6S %/m5f☀EMW6opdc He7K.^MXJZ)$d?> 04R̂ӉI"JNv`‘3/)[[&&s@2 '\ecyi3}|^#:S22:HAγ7ߔ8d<`7%XOx^XƯ\S"uSb}s&NxI[NͭznN p~>'{՜/=rfށf˲kf#(*I1FڒBk[nj6 Z[d:UJ^QƑ\Zmo'EJ"}Mg6 *ɑ[*lFcRkWSmžtK "9&Y䘟:M9S7?闖 sL2$mBL#&'ީ$*4mw$vn+X3weiعiz4&iImgW z/T2G&b6=-^xU9M ٖ?Cf1i޹iEUzzX^L/' -I2;n!FEn#ش'Oƒ= 8U->CMLĤq6y65wѾ}G1n c*&b_]m%z*01)sqt)nt&\`;s5β$*c.`Ս˳m)ӿc玬>$@L(nrraG:ں0MҔסCˌWѨ-/`t*ϖИH)1 @ILzøZ']ۤSs&k!+_q0x ],b" sL2:t1\ʳS[ %&f˳SCLfĤ, mR@;rM?;]խz[81);6iKxׁ8uNp ޲=ya_^HP.MFL U{5$HI-ɷt\͢;{yB$!ALʚ6r osh[՛e< b0TTzJIM׃޵\#]&krX:6\$'峫V3YFsLg{!qO "gh;N[blO_ zrK" ENO-a."G9@vʳzڴAL&9)tn^i/y02W-MߵꬱvB$!GL2nsY('Q" L*&HL + ދ!&edɚTKN)/+';<2.2Zm>L[~$٘$%y~1#pAAA, zG}&Tr.ʓ\hs .6:f8"1 I'Oɮ][7!J+&L3'N“9{:5Fj$Ssd*cM&B^+73鄧9t,g i,xvG~3qIr H-*=u#&!Bǁ}fM%"4!RYmǦO=} \L?ںZsۀd TM륵?g}I3i?6uNj3۸v+/jSI7'NP>o< EVo+vZ?kW?<~N vQwPUo>; {k HjGN/--uvJ~@vH$EL$V=9ٳN)5#ަrpipq/D1I-K. 1+VK7uBgL(RN>IvT.&=['ǿPǤ 勵@֘L"1I*n^­tqVۋLo}Es.rH֘4:`mropZUcxiI?~m/~/_._gI* #T/N%$ɶl̳|cTѻأn5ۦܖ9W,ww ?bR RٌEKs5g>>o[xfdHJÅ[]0dOϺcd\o"5G Y gm/IpIs2d;gPCElݒZhIL%Aobs"qYII\KKˑgu Hv1I~Ć^;L!IIΟ2 HQ,XĤ@Xc)>}MDo>i|LUxB[;NnWoz]7A&$H8uնJR Y7]\p!xmbϛIzCSuuBLBTt(eG}lo8ML(󢟼r@Å[+{*-y7ǣ1 gmJD!&B$\9z:ri|VuuW[Q;^d vif$1)(! )k~[ϑk?eWo?av-~GLvbgsL$1 HS@R)A௮gIv& :$NoQ^vwXgmgLmuu9:Ǝ.'zw LWr|EGy n9q}8*KGaf1i?-?BLBJ- r?c|QnrFVe;b2vkLcƊ#o--oЋmگzH ưe7yľQ91 !YH1f8*1 yE~' %$q6&qT`;bk{fڬ Nܜ5 o$ܧ4]w[Vz%Rwnv[Ơ `l H$z@jp+_iJ2V4sf;wC ʹϮZ~!Sm@Ĥr*G@Kዶn^"st%˩6~ڦU+˚Th g|~]?>}-*ɖzst2n1i, 6"ЧhEb4vIF@ԲgC9xY'R&1ں/u7Rˎuk6rIIXz DKEd/ZGC`{X_l")XfSL,;N˩M3j &\MI4RwUKp Rw=z33A"LI* ~"~ew-Ucuu&6Š+Iz98_8z9#K܎55[C-m_Yjl#|7xdF]OvfTݭzWdׁArdr?{l?!lrn%A8붟ɸG^;>]EIpG3mdIޗ`,che""oК!iޯ|!0>w]#v҄K`˶vˆ;OOVEV^}XBZVk]Zkכ^*Zۊ^a cP,s!@ +!9gg l9˜So8[$g>K St,wZeYߜ_ىu ~H@&*cSTǬiVK'u<%v2֕J~8j95~OGKݽWC~>Hz$ 9nm `Pi5t04ƕDOK}8A, &JkDuvZ[ ]J`;v/ΞѢڳk_o*@( %ֈY?F$KN|I;Yg@5HoIwpN-k@H`$2JnEF$yכm/`R&ܴz} ͐Vis7I>Slk.5"*?yqV0wfiCiί]e^]5P$QDB8R2H!ZILD[Sɴ!iX<'+П-yF$yDܶHJXC'Ӧ3ÿN"KQi2m@"GRqZ#ҶtLmbua4/ sP,kRKӇM?}tZKNkD՞knz:&C<1|u<ɴ4EN^@ q1iRʱ]#|[Lĭ\eL"v2mfӕBAXtinnnw(S\KtX?b_0 5"Agt)[.&i4icf̙7r Q.35}8!9(ND@);t RT~ec%h e=5Me;}@Jd;Ľz_.sVL1cFVVV04~MiIW"T5mڴx/} H]kqs,mN~6ԋ;'v H==W΢X'iZh1[le*Ӌ@^OiKkkcHT2#IWfPwW}Ƕ74>,&HQd-bH>tm`S|:} H]Z~ Qh L12D{p8&pSzG{a=c@R3Ҫ,IǺMv2~IBY ;ڙ1D,&Rʚ(@Xv}&٘#=i&z .m/nr3|9M}1w_bҵBUJ%ɴɍ8?-mqMрd7$L>a)ÑRIb k$I$ҋ3h;7)-#ۋ1! =B%< $YguoDo]Un#'DSD])ښ?0-l_WLԞGݷޚ4{tٖ_ I 6ֽŸ?kNaDyO |ӱeLR7 lhLLi ھ}SFBmP+;ab HڍOWv!}Kv"U#I掔ö= ?n|D.*aRvl?dC4 Yc?ηi5b׶ Sƅ@:iY'OޭyqR73MANMl555ds@f.ٯL1)76ۚV-S[/iJS+3ًi"noGyNIyŤB Kf <Z~ir#/~==~a.iHɴ. ANKѐ3zm.+ >vI62m4e8caF,$h@ꊵ_5:kouZ*Cg"nl4n$$oyaH,l{z{y5 ţX&$EHk)&E=DlFtMYivL=G~CzND$:a Ki]y>cF+׉JĶdMK# $4d#FOWW:$$m/nr79}[O0,Ak⊔®L1{YOL1Ǥ~" $d#xޭ 2S/{:o"n%h'K׶)̮^X,1Ȋ?z  aUt[=r~딕ƭz:2!aD>$T_y[$Hci֭ d!>rQDA&ᤣ Jf]/ait}Ljk^=t|ݶw{0}DAt A’ouxI=Ois6-v Э b{^]"4wMAzLz qm]4<FO)X+$'tOLڋv".Ϝٴ!%h3[LB@Hq[SJi"n5s'Hnod>&! $pzqӉnMGS H${LB@HJzV]~ -q\K/3h]IZV> <&! $y^G{&.5hԏ1 -[U/1  ŽL(p5cW||gHA5@l{q?⯟|j*G蹡7R$E3!A@7"r7[cWOdjh>zv;I1B@aI5&}6ۀdI<$0ŬILؓA5ODb B֍.b/ч={0ME@H>S/(.yA{e] Ba%=R@u^ŝ{}k~r>mzjOWW:$S@7G{]hi HHS&oSOsH@zz?)H!1$nmAtgkLr HFU?BW, i bA= +6u h@ە67:6KNC@HpFMArgI4 DAr5՞]~K]6QcS1]z#{R"{?7{>$T=x1Ƌ} HS%.]HKJHI=&.i%pC@Ò$彩G%a@?UTg$Fz@qNW7j9585d[e H˨tNW%HkW%$2騱A*'Wvƣ@ gX gcik 㖽)H+ sTm-誄)NJH:{FTT{֥wuTTyx/dgg'z/2H]HA|a H+~AXtinnnw UiMAѳCSD~W5 ya3g`PPPߛc%D|>M0}V}'g}{Rz{Z.i٪rј䡮3fdeeAzK^^ON1Dosm6mZSS5=cnI)LHtrkLB@QNNN۶ ƌDn48d0ޫ{:l*Y5&! ΓDOnn.F3}VJuUrH5Ti 6X;xvXcHuv${Z/9uRc2c2NM5&dz=&! Ńz5^bHe18̰ !dY0vf&tEZd$odgg'z/ K.M$afΜyAAA~oNN.kszOw3fdeeAz jڑ@X<9'uj\2}ӦT2j(WPIOSi rm|l;~vt|¡@JF *t*# <)k;8e5NJQK' +dP:H2Ҧc2NM^>3!-F{': )Zbze *5+'RiE6r\k3f}i18gN'!(WPɨt^A%=e$I)E,J'(WPɨt^A%=e$ !#L=A.]=z  T2F(`P|n!777X1cF/BI!:|R)J)//`δL(VӦMkjj2H?ȚsA~j ̜93;;^ے*j8Dg2R vf%QFiԟӣnSϩ.+++ 7Û'bz|rH%UPhEz*( }c%QFLmuSw+VX/}:3KFmEU! tTeTp(3I&Ԃgm3ک'S?ymU]S~EƽMqLM"]SRr@n6[oURfyz T+pҽJd[A'{Uϟ?OG]d.J$!gj}T/n۞RyG{$A痢]o&6T:#TI&i멟i*=Ӵt8iUɛ?K%J*i=$!gjRn.q;-NM(zyziVUkL۷cݬ?HQ%瞩F*鏅dCߝqhYHVR$/JZއRnVk-g_))`S2KIyrKd:nk URd$㏼KuЄ^K ᜈ#_ܱT2˨ġ֧d&)Z^yNgsSRvtFI3{Ii%Fնf*#=D#1 y(d0e)J&g?L(u+Uӻv0IviV31x*\O9H?2 Hݓ/U=NbdQC%L$!gj]-v1V>̎^.NO872isbv6U '#_kS Lڢ;DTz!8v HY{&HTzRɔ(J [6^NtVsQR~v)ӬleӅQ%isk"HQ%HTi**eTPI3Pt34o: S8Uޥk"үĔ 9o7h*ufR1VIKj,%i4?tGq*\OƉ)h3RTjkp]{x(&-+i|z&NrVRnFDcOcrwj^iJTdn*NS!{i3SKEV5.1JNe_z-CTIz:0̌c#Sh&K%SJ*?=CE':SzbK3J̬mYx@%cę:Q&B"B[YX~M2J( 3uD"U[[OMel=Jęz]h2sj4j"ˢMeImӑM $I y$+HiEP;Իd}tρ!KQHҧ^_9KߥZ"hH$i|G²V؆6Vfmvv߂ڬUv/,,kgŽU-}VΪwo+u[/^goAQcf3K5!#@|Qj>RƸc]gT0zao߂BU~z~}^o9~O:*:q곓gJN.9qXCh:AeKfi~=.(xd~k٦{2ĝ, Y%-^VS?s߳oKŢEuw-ZYտ?_sSOwT+CW^rϹNn8[~+=m_gWhUIƾiyi|L$_nsF^C5PWX`[šy;*Qh?vB3W.Cc /, >$ I(ǂ#W{/_t|͑ Ϳ+ػ`-BB'IJ2i25d)v1Nn ʑCODAj 'V}s +^xݡ?wЕPNx'OtDHJHG<128wH{GVW\SdM"ŀ{׆!#D>RS ?|/rQa킢%U~^]{ds_QY}j@ 8NQ$QM2, ' z$uJڄ X__垓]{j[*)e[Y:X`JjGf.7d$GH9ҫX?ZE ߵfqo~Qͼ{6Lq@g(8*D:؍8W{[^y^%!\=/y!HDYe~[{kA65OyYԀ$h$6AaS4*r̅D!$v[֢%PށZױEad̹-G+ZwnVkB$.j&iɂ=U;k~lAa❾EU Cg>@vK_ M5RQIGDyV9x;H3Ŗ j*gJ!u)Z) XM:/ 꽒$EFY^qH=#G6Xց]w_gԻXg%#dDQ 'ĂjG#$I Nv ⠢*U (ʈ68].KEFhhs)։{cc٢%EwV.,,;0jd5Z}fQ-3"ǰ|P /}bfҬ/;v2CXx^Yb!lt~K^_-7:rIedPW\M,>-m4-TԼt_6o{uj{LL/d$YT^bF1o_/ગ =~s ;*1a%5#qJGWm}hd";bs#jCsImT;{DDGnLPh-0LgϮQ7&kWc. 5ڰkHq|I5u~Hu9N=6|z~l6gXzWTRb1.ȉ!CIPԾID+EtlFY~!r(s2PѲvms#GGƍ"A p'>{vKE5v?py_ŭO-؏g$YT|$Kj"6džxV.}ޅpU2e es3TxMa#<Ey2ϩ$YpMZ_#YD1mQ$A:Y=R2?dN vV[lƚ;>ڸIoAQ=;o8::G2%1 /5x6  .Tog+ne˿7ѓ$e9aD9Y 9HEQRe=,ѾӃ5s\sw[+2>$}K$5 DC#UOn^PXxg{랿:ܬfY@-N$u&mf$Q9F`@@۹Jڅ0շUp65T>{B6 τ8.t$N[I Jl< [ZԅNDY]?xmE nde@g_Tƚ:n(ooQQOWJHCa8L[^'AXu*$9pj>>ՊLRÿJMjo*T4g~9WÏc!&>$ڔ-iAMLh\$s6+X}b2ZDHB?6U-[|IM\2=V>#i]NH$ɰ",6!sc- jW98x[7G#&_..&Uknso+Ccc&j/E&hRt D ]Rp'EO~]tU:n.goaamVqݽ{>Ϝ!#I_eӧ洌ċ 2$7tnIճ,R\|?[lUlY$oYlݬcm@`c867g'2xL~&Wukr-]Ia&n1"'@7+-Q巢ԯ`P,[[FVkARq 'r'u[NR:p|+&b|lN?GM}枱@0Črlf$QhL&bqj&i?9wwemc}ǴwG0a?DJ U w޵ T5I +Yj'h՝|쁻哯,[fo%4;|wb6sns36et$$]kM]Ko#mw>K6(]=6K^fvqyqXI/qd ry. GOpշ6|Gj{F~k[ʶ"Ql|!o{@Y;sC ٬oPSB>! 2Lcan7AV@He8q||rHA Hуo޷d{]V~C*UI%EٴKWHNmA9uL@⮲ofn >\X)=zt&bMr뷕Y7KKo(JߧؖyJRìQܫ_6C`a<,+hߎ|k},]/ȆKC;DFTqK]+QeDkX6IVQq? _w俅mGtht[b7Vߤ,Q>-|3JGʕRo M7q -n/~m48 ANdD""7"M\qٸfru  "Jw_Zx{]O hy4#I"H(H 1DŽੑ?!57Z&oK$ߤK9MI҉YL]_W>Q)pp;R$e[9^cmF _41|ݧӡI(D!qS8G1m nzq vK*\i{ ߎ~&dAVCVsmwȡDEiI&/Mb-+j?EܙG7Ypov&o 1|S(\|ֱmKɎܰ zsQkTNV\YEɯQ `(as$Ѽh45ym ߏՅyYNY%Q<֬FszcmH,KҼ H+( DҚ}lCXuU9죯&y,{oKo9k$j,25k4̸\xzY9b60Q"0$I"nΝPi~z4i-<3N:&s5?_LHD6)#P GU%r4vogϵg&_{JX9$MrȭV#hHM8q;\\x%^y^_srrqW_}u(Xl+}+ #Ɇ31|< {H ^]ܷVKÌm&{ӂ6nOd.15Js¢{p (~ѕ4`Gf|}GW>Zx xac9[ SiwOgp$z/AP0[(?[oZMMASIg h֑t?MӁ#7^/>MFZȑۅ+3$^-xլ1xRFDGHYq=Ta\$O\:E3M3|J9K_~# S~珿v=k7qu 8:HWQ R{͜ET8X/i *ISS K2lw k{a RbjiI{&ïv0 7&֎wH:AwvqXLI ]CL80y2IFǍ#q7~䄦0(!/EM"/Ѽ̥}Gޘ޴`Zqmop]ǎX7rRIpU^4f\ﻵ'r'ԞoYqf̵ձd9QkFU0UNdAiWs6詥l=A&o#ەP׽J*#?^PX}4H'Dov;Dܑd JsiօOE#,I_f?7PB# 㭡_#FNȇGG2 g2tAW~%㹀J,v:wiB񔸊Α(!p B;K–jX?UO8궵On [^sǧ9/Y8n?r_eL[lĵTx9Y;1.Z vHTy\`J11l6]?Ys;WCX$$ݫ؉H#F+6<$Mu# l۲+Ͱ4XFW6m):So VGHFv2Dz{FaG'Htn$Wi@#n?5ְEÝ{ZW /g03,߫?Z&ȅJM 1%Z,,$G $&Ά@w:œ 7/2T&wǶ4ꣵX?X+gq;u٫g`w\i&+a,qu[76j -wэL"GjC 4qf4^ˑ<ԓp vf)뵙"*F.3 I[ZEWS#~r|MvCHes2#?p߇#w}zm5.^FN[ ҆!C#_w'R7W05ĝ!-<(xt ߧS˖w7i핓+ v\X΂ql*w9\yʶ]u=L\AD*,G s,q&EW{3-8#4WpGӥGH&AQ\k3 {u-w wgEܯYjsRuWF~#YXX:穑#I<̭5)|!pOm #Z:U(!_Kgvl}np2Mv]q`B=gjI;r}5uK3дD!v%ӊ@\B\p{":S+)یOYח-g/}wWo%ˏoιw5'7iŗVG}'d\`pe_'y\A{;ޟ%5ı6AĐ$ep{;/ӜDrb*8ҋ[icu!eܹ;Fg7o&= K{ݎx IOiT+8~ i`W$ ۟g驭a<]`$і~VUcvCNyFRa@'fhSY8Wj-AФƑpDi{XR$NjC8X*wr uΒ-oG 浽HtdBA⇙,3!Z0㿔5ďx-<߀wAt# %\?aˁ$S ?x$1\)÷SOpo.oU#SU5e$C :D dYDPՍ#%Fn?q$Q BƂў\Ǹ,<ɱf73\8;aZT,%(o˄E|}R~_} Dώr:W8;7jf\ű+#}!-h!(.G!UC.:+Vepqܙt,{Àj ZM2 =Åъ$S ux1fpz-Y͵2,h$I :^ǒH"CͽCl|$3#ߍq}'ia$(~IdM .AnK]~aYQ KH%akg!4ղ:F*RaRO&6ǰt)bw[hsh4kjOt$M87clbl!Q$_4d'gve 4aXIPDHZ}l]쥑΋#F9w'x+-yG2iUݚѓk]e30n;7aNE DۮN*\Q8> 8՘" !Iv(MF=љs2]r\3OIn͚ 6|ƥ{ M}G%XAckuѠĈhq $$y"}v[͋%x̕9/u]$_ >ea$(XuI._&:i”]n>b$wbX)Elݖ[']K`JTT0&8fI# /5Msq I;B7k&AAH‰)#:6\}>Ws}oOKnu#n4GS$Mc0EWZKO57&0ismҌǹaBl­$YRR|+Yi~l|#}[&9>'%%Rk'.pYUw;/ ݼ/~= ACa C41*O{WylvPX԰ia9n!So%<&fv aŘmeiQVTg<(ܪp']xgiZjq}G/sb;; %qn}~}{<;zmoS\taI߄h^jܩ[|Qz[ʅ3w[޺6!H B H8a}еC'> rIs=v;ସ7 G0:؁4 cZ;Jyqϝkͩ'˾~[M%fm$P!ǵ_E_"_aW ,YwVny!.A\ۭIޗ3}ӂyZ~#omt3H61tl lݔeM*jUj@ĉ쩪jHxte48iRYq5Y?N&pyK)c2]PՊ0$RCg[dv':ny;6-/8jדT꣣!RoL/܀o~TPr5p(}BDL,#CZ|=Fbu6`h3GCw(Ȏ%eZ`DBHZ|N2Jf)Egׅulf9kg?K>qҐk\s^ڗNًLJj[_0+.OϜ+p! >RQb[OXW8#`FtԐ,%-Kx^`E(p$ɴ/N3pf<HUynyIAh'1Ha!LbJnh<_'1˰%?Xtp֘IyvD{<&2f颏/l;|bKS]}Z!_-CrG  bXD'&/ψ+)Fh{BD/'^ζy yub}jH )ay,GrJ Rb:&Z~lo͌)ʟq誶4Ef?(XH,0v24IX˹+!3w&'Y}998&i h!! VC*R*9 )UJ "jSRC 9P@ wR( B S#$᤼q銰wS4;/G75,+.e-#\fZ@p2#II F vIsM=A]smE)hd! 11K70,hR A0ð$ȒBxPS}I%&E#p5ޣ+#JȟPW[)˜wr++fsm ߏpŋIMR8 w_/}X#+ۺ0[ Ͳ,I38I⸠K1A`5԰J-PC4Qޚa'hȾ.-y?$^P4'(0`NLOd{Dgڱo$i%,Kkz##cmδY Guͅ Nw ɰp &xvr'<'W/|ٗ^7XSU[vA"# ?{g ]DQiA79}=ψgS!tVxu8Fmnq[WN.7SL>^$RTf-#u]W'EH~x:E34grc-JF*+D\)OcP%&J(4ղZL{. ۳U"#I endstream endobj 31 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/Annots[ 33 0 R] /MediaBox[ 0 0 595.32 841.92] /Contents 32 0 R/Group<>/Tabs/S/StructParents 2>> endobj 32 0 obj <> stream xZKo8a6-R$%AqY ػ{tˎ2v#>9MURni1mXůzI}js;kGs\::u=6E8:]npՃ#vtrz^"Q4%KdUbO&K`22TsTW"q~rҢQ&[ n}*9 _=F4Z" 0d2cr{ؓg`CMS^iY6* SŤIy6F VX,L.ByfA&A Px!?**XJ]7\YЍ4ǣ@p]]oS #1Qt,l#qY)Recn!q2B_5${0xDFxt̓ӫeF:^\uՐ8͓xL J$$73q-F9qiF "%t,&WHKar,*dR\P{P. Ou !~z aS@O͈z e3:CJ_999;^̐;-\^Ȼ{jVKN a8(m<(Mq5&muCҀu* Ըݮ+.>&>eܾ ۪ ˮWy]mA\&> "SO-mV(Nw1ס#-b(e72*W9vVE]J$gL*yijP_AGGs-?+pdgп-ʭ3Y`M;-m $CmJx ;/e9|JT"5tn}`ұ.U_?”0< .:$ݐڙO8M;{W/h/>P]-qmP"rwK@.B5v*R5>Koʯ~&G7ki1+ Uis:V\RbC;W]47p-`%QHD޵'OFn ٔj{YQ2X%txIω޳7W誵?y omRSu nc)[eB}gLG!mz="UE+0tLo*F,.qwM'<]/YN'ZbsO"y^P^:X_ ZoOS ]Z(,h]pFmCLzo$bl}לlݜP =NDYIlj!bDQ~*1m!3ɱmo6bU~4^JI|FAϧ*)B REKPnF-)sL Z{jභ[NVm?nQ!Hd9~7UTմsCCE;N?i bۇn;v3VPG [[_B!j(H|`Yr W {eb/i-c.RM{>1݈+ˉ/٭_NTedWeihK)~''iX:tnN: KWҚ7vcWy zKnR+R9kTIB$@O*r."\+гpj$}|ε;rlT? endstream endobj 33 0 obj <>/F 4/A<>/StructParent 3>> endobj 34 0 obj <> stream x{TSwֹu:Y眮Ygs:t:9L;i؎uhVQ:  "D! r) ! "p(nrk핅Xt:]XXDw`š ,>Aj0yyynkٶneJlz?nٲ?Fe/G.|1c⠤\.={]8 e >`c20Dq%>XɅw1.۸K7J3c_<Fm%9E>$ %WjwwRX7x..KLxك`erE1f4d x..0\p>?s ӝ݅<N EQ=2']*b*Z6mb]r>k3Wy[@HˆOdΎ1 BB,s;  4mLMl?M]E1yai 1Lq[#0nۙ7:2-@#'3 㶍o-Pؖ37zg{soP[T,M\:> c c}9лژx3LUFu"BUu[j0-}nm4%hM v-_ @pX-=\Ϸnc wef송2KZ~eczK鹁am^iM y7E_\~_\)7~; _@0gPYQ_Qed{7PQ Zr?C~费4C~Edin*q) Xto_2,#q߱c薋ίuu[:)cG pX(ڿam?cprd/hUdܥ0Cm>&EћW.\~EiJe`% S(Ǥdyc֫-Uܥ0(ܯ O&S.Gӭ;@Q$vևܘw ] C] l?M]E1iCCCvX~Tbo?7-ƪ.GmWeB@'N(3N GJɜK1R/›OfV*`:tԘ W\6RԻawشKaHfO땯>pSz.1>8w}1*(ΰ1&[-rlr]$= _@;u\.ncn^q*"<]:_{*KY}.V#y5)Q1鲄@Xmٷ=0ɫLuǘjvDCac3L|ٴrP>IJ9F9էZ*H>O.37RP%E>rͰP(F`00bO'%UOxⵞf8&ho7]E'ZĘ& > R ZήAa1e(  ulu_{cqcys]{? `%j[{M&3,V"Ke0$F;f0gm.q?:d., [g1hqt˳ c])x0cn\S/s=9M .f 7ח搌1@ VvۜŘPTL|+HVA 1S]j V&&&#>dfJLueH |1OojĢfgg#!ac]|*H+W)0/To ܄j0yyym6֭[?ILL?Րڎ7$3^SGII cw*H+Ex-Μx>, z=Ga1ܲe{ùTl3hďZWYcccJRXbgS(*H+efL<ɿF_)1nr8Wؼ{?SmSΞja(1e fE0137z`EU 8 %6/1ʰS[~kU=`b{+geX͔XTSbr\|+_'$Jl^c|q[Lѝ9#ɧLLL0(/dyuelvȘ[:%`i13#`f].JF_X31Vk?p01{- FuBH̍/oP01V.15<<̔X"9FUBT)ⵃ3j`AG.HLܫ~*~VebS*HC&>:7=`/xu'Ʈ~ mVt?ڙ92&q`!CXZ@@2 Tbnǘ\mfb,xؘRXRaVAZ[\e8cm8 .a=1&(ď`2gQb5:m/[ (XLvK<[G>}X)dژS)@@3_~(0~{|U<{02<1|/cX)t̍LEk:~Yj' cy]a&"n3{ZS*s*HFUReflqFsm/-b +w|y;%.:ƒ.01 ̰إİ RH11vz"N2mۋTbmcMZ7ycsGy+og'j&nbb ..J/&r]a|v4/_El6pE'ig>%A>p!}Jii`5Yij,sǘL&fXh*H0cBMgntr?ӵ%K'5!!3p/V2ƔA&b05 {2y*H!X͔XTA ;uPlǬ[/qرct}7/ "b #ycK L՚p8*18 TJܤXdsjO\qcLdm];_G\|w5aJGe RHP21V[충~?I=/dʥ˥UV^b#MYMs|ۍ[{wzĨ oEg9))<:_tFfd?Ǵ21XS1- 4WXa{G3S 333P%,8=^ 0O)1ZyVW3~La[ E_\7c*=qrKcaN~&'k>sS6/yc͊n&Ʈ~?pTTT0t54?oBWa[*c_9W?uꤧt:K{SVViq:x?Q71ggLLL0( ʏ3oš2!%ER\JL .PQddd z%^Ѿ9&#cOWx`yk|Ni0bʞi@GGF\cw>*rfHM-,ommu8:ca>RRROoEJSAhJK511v_*捬bMecN>ϿXrnCzE$y4EuE08IQ&)eb,ps2=\ +_fuohb_=LSb;J9\<&~҃08ڕҾplr!.&n1.VO+*1~1hz#$3_31[CMo9jq&+ap 4iߴp8{LQQ['0f1hllKѣ :Cdm/o;{zAB1V1FسV VEXq0cy˽Zּ<[X"9.2Lxզ_cpdNq(eFUUUӓJ WG%F[vgXe#cW ez‚&a}pn6F!-n'3MC{701V/Ťfwܝ@;KLU~My+ow}}=V0ݷMkg[,Y[\d1P:,`™Qm:2IN'U*#TA k12c 32{s`j߿rH}+<p6lH76ZLZ-jĢZwQ;ٸ\OCwCL]`d”fE7?{d2\ [s>e^17] ^v~%J>C ֹI?< 70866=Z'L ̣ĘcL631StϝgG28s= M ɖK ̖6igcK_jcy(\iJVxDcJI3Ęul6[AA08YYYb<0:::V=Y[\e8c[\;;966&1R)',B~)ww_}fM&ƪ::{1)'Oq2&pIId˺*9x-a/OSW>q힛;I*J,1I:.,,,n&>9`y G &7//>ӗ ]% 6;f=7+k1FTs.577 zf6cXdE#$ '<}xFA;ϝ,xHI;ohï6$Dp]U }IEXc7MNMJX-g90%oKOO2WIUYkkdvD2/ۥ5)Q{^trz/{MSf Nr@3Աrn*QA]O,&r`%?MJ7[(ߕ}fጛ1V>"?msu]PljUUU EL$9gvĘ]ԇ6^y5b hs~ݶ5ŭ2wSbUο# H03#`f].F3Z9%F&KQq?ƒcb,{UԬݠ*ZDQQqs"m^k[1_>nCciՏI%1>^+ s1.n>[ìs C%jXnKRgl;Zo.1Xy|Id*kK;\i2K;se&{§uo~vS'Լ{;C|FsբETYqqqV;0ݎ c}wQur|nf>ÿVv:Eca't'7b3WFPj-E:uW? 1a_ŝC_d%\jvw aqC[.3L>:Wh7GjKuz]lY0nuvY~7nܨ*,,4(NsY{#a-/[.t;>p CIj~ܜ/3roj.ø_>ƸmTS~1;Q׶%i~n)頿ŷCq;wuTrf#_o?g%3 bK7Ћ]jP[Atq'溗y+$?#V CHۼ}|l;dm=03{.6]S\>g-߾)2=>3qcu|?uMc=_ O ^>ixSB1\bqC9#K+]|O5K߾'(C-VlK؁Usu)+sSW{/>,.KW/7~۟X9\;)&X$y.WU,bd:}ˣm6CwbrLq[j JgjpUeYSGq1v+߼,yeU;3 '( ÓK Qeu5բA'G`B?-<`썯Uk0f*^VKeC*`]6m~Zeee ܜmz0׬KQnsf'&Nsgp1~pLJ_ÔRWZ矬~PwX\e&%EvtFN70'Owv4SLҊ0Պ}1V\|rG {?VcsGK*VUdkӽ\,<%YbE+ܶuڟk,ݶf|2gϗI#nCh\mrqoSӭ7;,Z 1n*cW?ߒK)55PV-W6SԵ)|}cIF7&~{:yo#n^slѸ*sa|SbCU%@;{.oܗgV~.QoZnN4=7ԭKj?Awӭc͵%y_0B^WYqD[6oiJh-} ;(s5Pi~f36fv7=r3===?C'N07W*;&jSgg4[^~ڿ7e_$ތW/<9Řek3X b,ɝKFu5 uluZFϭR[w@ͼ}rL`雂^WG1N___ZZZ(f0Ɗ™|;>*: Zfz<Ǐ _ JNS].Va*7Z7 9M L-+̍vAv,S(ħ~B1Xrmqc՚,>~[t_fsGGYx0ٹKQԌc™BN>?LƘ5K _%C"Ö6ƨ?S*41f^%a܉T3O>̌iM mL-ӋKqeޅsu.cLs`pyKl4Kcn%W*wmxxtxEїK+%mWO~W~rY(LgGQӏ:aFϟr qѯD3Lv/o?/5س-,R(]8ƾ}M2Þ]$mo.gwtNyr],2tWf,g0-櫽zKso(cKȅ7I~ gX _wc.Wd.z,2]2Kή=% [_=3nJtU'3MO*=/Uytͼ]yySդ+ti B@!ڀ%7c#cFx_$+"˖mٲd4G>JZlN2]ΕXR0>͚:;;Ye҂$cr^ͪvvIX`8JKߏE}g0 U|]hX+ٶ }ɕ6Q֞ Bvlc_\$]ukYCèK j8|l{LKlЕ%Ȝ Tѓ%at\_Î-1SIgk;6H|Hiضwc bf{3zM2eV S>/zioniǘՒ.+A(+S|ً]CR1԰AKR01 gA+qD\i $cۢ5l^;rEtnsD59*cO4 Ϭ,}u4ǷbX}%a%h uC5&S2G;M,GK^[+Sy.\IqĶw/;BOd3s/D 3 d>%a۝.Ra3FN2fZpJĽBXAhS:𫔌)^$5j+MKZ-Av:IU4/-mtڳEh 2f +S*ژnvI iE'f| mN7ʘJ㒰%Ȏu.ƒ5\n c|pdp\<6vP3VAqf~]ˮȵq!b1%a [%a]+JJinx7@jP~$n^~s 8 ˛3e+&P(i$3\gM)I%a [%a >>,0>)҇r:$ QCL9n; >sqFy]b~[\3}nb'r78xBV|E g#h$dYc2.@6԰a|4lLg@t8HªaOd,Hgy'w`a;ߋ Z,l=#}U$Ek# uDLΟ\i03e쁦v:|,rbB/>%a*$" HÈ 5f.y~<$dVx^q`1&ƿfvagCH956kuDLN\QvnbE-ItzfAo|k[e$|s[k$lD3)]{mIÈ/KU\aVۦȦ4kiiaj&<<\*'1N{.zCn:ƞhX 21"c&ვIs1fi[> ?tAE LãU6F,dOKs%&&jI_444 wx:'Wj&東=p B -=^5ZjSo2yt%?/.ًz"ڨn=#̒/CV!2n 9E"9z{CٮA헡wwV| cQiQf[d6t̕L],cCCCW\aհИ"?99Y"MNF]"y_凤:oHя4a>)&Jno1ralhJ+d]qbzsy/!d,,,̪ H׊[\٠,ة-Bmie7oUSk!BcӐ'ca_sԆ+*zTG+מb _*~㦢1E?~Lm_i &W8tnvXH=].ch'-鉐(=|T^ꓲO6WX]_vCOfkӠ{D=TUbB[ȩY!˲/N 4R7;s|;2+'Gϝ`*Q|f+.ԕU %N*f5@p>cƶ:x3;3M=^?ǵj~0YI2fᦦ,ZJ]O4괽"/E?tRqҥ@1E?;z:'EP1EbG{ZnΪ}he`XV4|9ag? &̠8׳3eiG-? [=O1 ×+ZW?1d_tkw[e`(S[9"<`4[WuHJ'r*A܌csDr .7~_=Ub1-dNkXMb*X\7pYZO,g"#N*QVvk"5<R&grPJMڈfX;ՌH?E[Oe"|}؉'W5kY^he,J%HO9kVu$D=wkSZZ`Z8PlCd\aԜ$׵R4%v5wզe\\\XX$ӕ}+4mSpI7k2z_YtnJmeH/x9E< {Ľrj#Cݢa |,Tc*IQuQ eR4{/\si5l^2~$4^!` %abΟ=xvqIoPw>cJJlӂCYdYQwz? &_Tw͏y&f7;iy{w~e<,Ɖ]"rRHDgPFoUne?37.xӘKK?]h:\OSpa5"볥>T"^#4lJ17=s2f7p:)^q))W2&(/E)S5 J^j'j]9S˔PV .]{g/X)l^J=D U%sR8>/f cGяGq>>1.tX0[X5w4guB&0]+u|ßё>s-7E6q>?pwDxIyԴb؝Ubji{DH J( |eLJu2?FPB$E[]A齧a=ZS9aIM9fU }OhBez2-?O }bYQ ]Q YM8t/$cQQQ%%%ʳI_M,>\J;SJ_X ~Ll6D iLJ$qQl0HKίT^S+'Kc%ï2+r] csC6M2pƢ"]L\PUL6/,bUܔ!kj JHê MzhkMGVxa\InPbz]~i_-[-fEZ W CgddP&pXH=r*,z[u9{5Yn.6%0;]>1_<;3$U>4W%o(V.6Qkv_qW-3kcec`%N7,GN,%(g5\V.l@6Ȕ1ff%AK11-2 1hE-̕`TP*_?H78!T!S2_i/:L @@܇M2F/KiY#>/-o{XBM,>>33&J_eXoߨ+>Z1)1Vk1QC"Lͥl1'/Z볳/$Ik_%`ڸr&''gܶmqO]Qڔ_) C?߸S!cƑ"`J&sId\ Y^$ci7Ll?2FIݻBE@L~Z( [J50k^YJ&l,[$k.BST>)ṗHƦe,~mPPq瀀$ c "@Ö2Ũ2(T20hec%~UYXԻ'05U\#&s'c&ˑJa"LԚ}_ZKEQMP'W/| Zh_m4< b13XŌp dL XTgduqdhVS*Rf)`{g,epXaZvg@d3 ~0+lbh<Z,^Ը»|]omKPNmҁ-g2ʀlE‰}nMi=nx6V~d?'UVcbM4a\ 1MQ2sgw x: dlݷw KA&2/Q|qE//mq^=1zG;ݒt;Zǯu9l"Xnbx1w&D~)hn)r)M"l3rֆuP=|>A!L O +PkS:,j{.u+”16#2FYin`#XZv#d Oˋ3~V;`yR3s$ʁXN+'&/% s*rx&ȵ|E C18"{T6|@xEyg.z}Fc^^s*%{;c*5YRrW\`J&&zeONN1RBW<ƑAdlAiXFQH;:8U7,LaIJG ꆇYRBW<⚡ͧ,.K/?k|$P97RY+}!{%TwgJ( |`R%JzqZ'F*eCt;8u*Џk+$ZH8"UCFHeJ~❾.c>֩G{*&tk9=c [t`XN{y*en.!cŗCWjq KJCe|(A7#S)SRr,:$stK!{K؃L715#K0TB_@W#}:b>͸8lPHܴj%c'ߥXP=A̩q@W)ȵ[UH%zɞ WP&-&NI=e=9||JGϐR2I6hUcWt ImBr'AW7|'cS$mLg1g4-M*_A&+b#AF17+J ^X)cۮɷ=[mt_Ӕa7&vd~U7{;FW䅶fR%J2);kfD&&+;}hRB!cm|spHV7}mAa.Ơ:V MMҗoH71uVfN(` *2z1):Ctnb+Un0dLo(O2@a*)s*x-n\]@8?}C1=^hz%uW9 J) U;rJ ߡkJ=,οPGgoj$]#[J7K9oGFc~ 0Vrʽa2ͷe504jg`(ο3}Xzfi}Q =JNρ:.-^DX"8GiY؅u㯣6pdYk8<yIq}wޑ~Eװ|gxTtk(o2BÞMA0hljjvjG8ք/&Ut{P%)cW_zN Khq 鱃)4>.0=J~ʃRBƾK7櫦Web٫6=u^Rq  ` c]]S{.M ]*6iJa1Mڄ^u-n Xꆽ-I`&ȹ^B*G+8C7}jSVRֽ|UBCCCTVUdbhׇ <v0- 1aW\+!ca#Vٌelwgt[FZlJ1JEu>dҰLT*{Kɂ G5ᩌ)*cv aŅ$abcZWkʾ=B71OgQׂaMjEk2֨o-eLq7ӷT( cͨ|nb_E\nAظ4Sy^k~ZD*YkLx M"Ԥys^ÎcYuag՞OIIƅw@F5998mۘ;oiAH{頛؁ub[/)Č$0wDaT>vf ;O&3x,ZxmZ8ҽz!OT*,nC8.fm޼'ݚ"ڽ{7=FI@2KÑ0 ]dT !%ź:ҍ;¨3Oۚ\!ntv}LxGD [D'%KƢ571H4CxB 2=.u$tX,hTp$%T.XH.6j֥N71}OCbRZ{Ұ1ìצza $Lx{%-h4ĢhZٗc (11t,k?> ahą0vnbwq Ϗ%1ʎ^{NbQ=yd? cT]{F#s#iܙm8t9A+^^E(Z$J,fX @ $XS*)JQF|=O->cERSTU /s@&Hgr31MmY L ٰ&E7{=C&t1/O#[yPۣ7יGښⰉBܱ3pSs=KƑ#o/v sG^=%l$3vsl4~s g&^|8)xywMvw1+*%6t!fF;vMWiP:K^B;7m_{p䊊 wwSW&8*b `xg"pφt˩Iw K0,yHշD2|1V6(뒢 듺_{̱;8:j"`~v\vnjj~:ں| XPP`> 'KV&nHU/mG4_sӦ*2FdS+֦^,R7IwhZ;L {2+h\\\HHzrmz?GGG+**8,##]^Lp̝d¬F b1U,\ 0;/t+jIb9fK}nb nh[R7/URDg 3GaiiǚDiDE/Jo0+cD??Y,-- CUئ_!ڹs'3vŌ6<=3UAT&إRoú2|d̷ C[;dlfj(s2򨡯Aw9mc,iE [C*9j?>ֺ#%8aKÚe@\ yg1ʷM*_읿z2MR1DC9{ɩ+Zr0M*yVD!lxjOq0c CFFk=cO&I6H؞2֠0JSB >lf0dlHٛ|گXC(?-c*pEE˗Y;;4 !f0Gk=Xtfv=ApnbkIȘi0 o[O޶{z87*CJE߹31Wj-qM9oNڲĄ =zՅG?#""]ɻ{/.8CoW+c#Jɡ#C{kB+~]RPQftE^䦔-{~S:_kuR墭TjY,M]f{ڥGYqKڻGCaqlVA ƅJ7s()B'Xw:~C&3]4 cbmjYz+k\KJ'iXOH|FUz7=h|x:"OvȼVWض6 A2v&"}1뷒uMK{$w)3y~Rk#9*RDG*=l J?}8G yjZ^zQZU5 2 fik`MͣKUYd>RfSI3dG*9q}W>qF'X8ZZej_RT5u#A\nn񅬌OML'aVw0UO* U:#5.Jw++^],*ߑծ`ޫ.BWnVհWQz-ǚXi-0{^BäFlUfl{@$f5lJYKn鳔Z}`F'X gEzM]oZNܠ'ݗ2 &*cdbZ cznU vRr[ SHmU_fxhbtZ7Xzhnϑf4 @,hgMl]o^TTe̚=+{u9؍kZT7 :#Oגۖu?>:b7j[UIm|Cf;{J_Y 0+؜l ؋V˜L|F+56E.c?He};ܹ39oDjҌNo֓=O{Fڑـز%0OZvľ)JviJd̚4LCƲʫm SwI1RyС]v÷|MA'Xtw%ԯԪ5BCWUlCf@Qg1&%?AUaLwq#%)d\^]r!"T4BQ1tE=:)a7]e+ >Ru)͹nG0-{dQf_u轊=O#c SJ۷ogfQj,2Wj}NļlUհONuZ Ī;ɥM6%z)SZRFZZI2Na+$[gl0k6&\1\y8NG1ūnZH}}}ZVWWN`vS5V}9"R|AK6Eʄ1rR~B$ SJXRR7JԪ&Xyj͑H~ be:aLАƧd2օ)%d2F~E+{VjR"ɕ&l$aLHzʋ SR$EJl?AE*M;Ya^#=41! ”"`탆0wTjH}WVb931B~)dsXY\Aw<ӥS5t3T[Xf0&$c5-ʋv?!01-UR릔(RP5fM,v; Ƅd,2 S!'dʦ~+ (RLkb6P&ϸIWL-cP]R?D;EL>Ɖ'֕󓒇" p|!+c!0ަg-Z:r2ֺDuaJA6ܥA=&]ǯ?;*cZ)(RhMĊrdH c> 6d,b S_2F\*bP)e˴T֕隮arۑծS"DX#b|9 aʘp,L;FX#\*bP󑄊4jG^U8T{~T~v&B[AtOdumї1)ujk_k~LUÞZsšQy˔;PaLXd:DÞ{ հΐY$c ן0"v;kbv6a~vݗLȸ땭e2@1|a(rOQ!E[ ~H֢Y`hM^{*@ C `Y̬m+\FUƨI.tՒQk+U|#" =ю&݉O^?FSU$TRZX"&L^DjXԋTNGm0ql#Xr3&{xd a[fV|mkӛ*'֯v*t$TVVNZ4"`Ϭ "Dzc9:B:vװ&Vݙ$c/]іN'cݣq0e}r[z~yޢ6I>9ՙRv+b_E`ڋ"Tú#&0 k6&ZEkK"cv[sA\׻ Y0M)-c\_3g:bТ_fPɻY cf'm} m}.'7绵A/ };_ק4_N|Td%/=]]T|l6HpFN ' oד30وben=rM+[[3u,QLv5jOT<[c jB>۞k ʀd셯u}yBI)ZFluR墭*S+nSb^4_Ǻih\%ӗ.̳fkݜި .{!2#] Sj%KWoW,eo^F?JiKgĔhhu]C+U)^Ѹߊyh\e?q+c0XŸs5W S6w+_ti{rCo%iQvCDdkʘHDh\"GW5.䮼a=O0ٲGTЙ20eW OȧS#Wm~aj+c" {Pg`?>Q/"`qa---˗/#v&V= .ߟEkaJ 5uaZ4GaDuƆlbNW q#վV4Dr9+.5Lƍ''mV,r6- 5oZ#c#.U ”~icR_EBbA$aətm~G!WE㺶B4.[h\\OCf锗O&>A7y@rs/de6l1'ƧtdLkaJeoB>|˧:uzLY_\.KW2-K̬8cWݢq5/Db\1KI2&fZJ*[sYt|S5_eQDQl8{u|.}eq3Ҭdi:UdYK)*o}'C}+).V>"3OnLO?2;m`_o(q?n$/Uؒ_Ӻ>]s,{[/H!qiW] ْl/ErqK%(Q6R5 lOyhD@s*5O{5xB|Fs֧_R{pJXn{*jZ@O+_l0KH]K]S3 y//  \xh[w<1^`M&锛>`as@1-{d ?8v?k S:~CRO]Q|U#cSLȿ>HgM'\͋X۱p=,O*ju^ N1Ŷ•UwG}2W\8/Z2-mS+'dA}h2|weS#]qVi"1  Xb> M:s'l@ܓlbM,fKO&=w)el”JyhX11r'=~[Ϧ\XKuUVXUc ޜ.:@IkŊCK{>Pd?"z5r%L11qqіEQOjRqY35R F6&6Wq&F(iǗ4q"ԒMdu/Vƺ mgT_;]Td56]o5纖ʪEe+hֈ$x%cMQ ?22BMG^ϕ)uG`zyD4w[\)ľ)ŝO)edӪܒKS3@cdj$tWiVze;G?ek3ofq׉Dzc9:da*TȖd;HOl[X՘ݡ?_!cga155jXymO*`U?{̈ ~9ְ5#~2=,؆~rK5,S#5fVķsS H237 +|4ZYۜ,{4~&J֖w_oK꺆55H+[WO[Sb4nb5̏ +0'wl80j& {^ FNtʞ7W͋}~T {L`l#DV`MĊrGrd2 Ӓ/O5.S Pjh+gV0r?W=UX@-{\qH1XdCJFʘh1D]V梽S$|kV09i5;/'۔sG;~9d5D{4K٪d G~d_U=5y]b쟚&^Da!v;kbRG\,1Sa~W%ߛk+|~u)2tGQN ՝m+\=C)cgQ*ϯO͈ S O &F';+ce.@\`uCr f[JĪ;G~2t[4l@콌2 8ՔšXZh5wi؞g5&1h"֪uEA.7'[sASyͦ=e5Yz-QAɕ&F#;GtUwSa^#3"R5_G-^d}UV.7Gb&El_ΩfƓ elw]m|1zv죽)0ː+f .ِ̚A}ÿGat5Zˉtn'%[3˨F^W  !Wa鷗Uޏo괷^ ҕYxчC6_H^/m[Jlt6v[CɮW6pL}E$>$=;P'a~(j+S:9_.,hɒ:G{  ]f cQ'~ҸauglRhb3Kf < c-J[Q[6F[ LfCv=̠h+h=B-v;W)elE//@v=@%h*@$Az(QeCCC917NNNF{Gټd:G333"fǭ^Ze1KI$fZJr-bbsYȖ ^ Yg۽m6AI3L$&F_T dRVR1SebthR5 }eq3RdK¦3XI<=&v R.:&Ft*R%IH9fa"DuG'Kl>)b%,ThD &s@LA04@LI%*a2*']X@LA0 4@LA0)ʮ*D(wXBzH6vIzdҾ5Q%,p 4@LcA< 4t$VY_lˋ}Jb8p`i  `8ǴF$# `i, `v@KKc! j 51DîZ]IRdz 48s0 K\#.賔qWf_nL^\fKHHXr,ʩJP!Q5Ĕ1H7[ 11ѐ݈K9?X K?E#sA>:N֓Ig6zsC* Yj!SS4 ̩E'_:GJRQ D5t_ad1L˗/2:?YX]Ɯ^8:pZ,3q|[1([vcen!.slxxXA6b(EC= ל*.x%E EMIfMX,ҹ'}aJ'"|a 5$9{JD7ы"!8kv觓ClgVX!1tLP!BY epd'󜍪\5zKh 5y⬞EM@{~_Y1StΞˈEP@XTM?gb#GvX!1h(4G$dDCA:V(@C@dƠOٳfc` ST"2tx^ i} G_JUOmT7QfB*M, U ?%XB \g}D^u(:_~3Lb,:/eU:?y(1$Z)as=@r V㊳.MDDkbA_T!zչU6,: ~ML?wNۘlO Ф5$K\>E%"sAE,@)4`{/эQQe+>1 _1 5ps8 !\eo7ы"ց +X:*Vss2yL<8IOs@T/ c(hQRe 9!NkH{,),hb147s7A*!AO%i ("+W7400 %E?r->ώ':eX|YHVb5гDQth.GUL? bb:aT,%& ߁5$% D$/(Sgp0| 0J>Kٛ6 Q }9b>[C@%pAuHbtpp0ǣ:?p9ðH՛xoq3~[S8^G G6s<<bɯyqqK^z}-q7hvv ?t?.x<׼ϖ_pΖhw:[ځVrz邌G͏(yzMugMWw,Tvfw5Rn9{31g8rMGa`N x\wF=8>&Έ&uՂ0 jbN)AQ,#io4PJrk8V>m2O+IzG~a^ptqUÎvawLOYyˤSpV#%t9y~lblnwZ{ojJ*\ƭӂ0thOt駀`6!֢0`Mu6c 2J?Zӌ⇲.{jw=CC9:O=b_1ee~X;H$)*{Dִ(y 'Y]r:Oqy|N0+x='IgxSexzїmXd&28aI4
    5  XI/b D@ @O^-sn'.e䕆}O~$yLFZJM/DF"&p09dW>ɹ=i_Ybb!# V3DcϘ%,.aLp;s}gQ' C^YHRx%BP(Ł +nJ؟4.NYY2Xa"nSTGz DY1 #WM .z4O)o3p2\a3Lw0^~%td3^`8Y5{)U, b^5yhD}JuFV;IC( BX(Hh+o 966M%H=`OoR\&qPF̵)C =\ r|L!P\adB3NuԤxu~#v_:-Y8$( Kn7C ,aJ5kʋ zhBP(!]{8}ށt,%׷e\Ox1tPeЁZi4g]*-τ9(8'ݽ)a=10FT4QOnWfhNEꡉ( BP,㋏g?w8sȱIOΑ7 ?1ٗx@tu3ZI l\. eQ1'X䅯LKf\o"f;ugUm[ Jy)>f띳kb=ac̍oU[ؗQ( Bl`}˩ؤqqCg&SwhR{%ecC\eկ^0K|p3*e6;ΰW6i$ua": Y]CX1ZN1zDnjb)DN'ߘxܤHNR( B`e7~0$.'650BD 51CĆ|Ir.a&k̳ \9Z2],e+JmI]P3i;%bu`\; 霾S$3 Z|!ϩ3{~70@`  ’ֆՑqSDy'%jb=軋Ö"c.? - YO/h.gbD~J}@+=Y~LLLdd22io7Y;:h.3?bܫr죟f$ˏ1ir̙~' $$$rNmv%c&5K߲ \f/|^{ATǸ7 ~-''\oJI%[Pኣtu0f/&v}0LjI |YfjH.qP69H$f;F@ oz~lj<2{MGO n]b԰cɏfib6`а8&Vf>eQ <=﫦A<#Xda~?c*|'N&dp\v|ȭ!#L̢. ={KLjEMi-O}%&'6- +P:𞕾%CzA1`ЉLeW?nRP荪 R[(YKU/)UmEj/JuIfPj&Kߓn.Fe~B=.r$68eml%T8]b^`3Dcb jW¢=~ɷ"<|ӞiNxƠa2l7}-$e.ke!nZ~=_^tEnR=nK*4w֐[_?othIĥˏOzI<ڨa"oT u|#7񷨉=M̌MM ("PMk SWVK"!  -}]9#pwJ BwV\e-XɍAKņA\ꞓjk5/\-;tY1;Xh9vfl;jbVEWW~uaE{nv%C'f&Pi6=e+~`޿m Mr5qdL.wVzLri#˘Lrrq r\4wHKR:ڰ/f\&;$w=%lqI~~O~ Hܥp~2&m__kM+0H7r9hM;RT;XyT$)JKR\cߝ>Q7z `o\(c}M JmXxu䩊[㊩4vywOavUS+\tɰ3}pp1ר.Sygr5L.jjӌsd_dS)::z۶mj]~ O3{aSS<),ksetQ,E%V-(8/@p%+7C} e}kb#scB:O-{\9x>;?]fM+m;Ɵ&=?v}e+K?sՎ_<!A|d΢OMб<< !0fSv-#89?r;ڈl{X`'d;L/ͧv_%܈vb-3:c*ݳn!F^W&$ BP&DU`ٜ% O MJ)m+~GՎBu#W|ըML?f8ۖ\_Rf^EB#urP F_oiw: cO) BPF/W$MI]Q3!ødrBH YXuErf$i?,6E#q5WgױskA=OS6?R|&„nRgh/ oi-ە1HMRghl7ÀC֛MNX \-P( bHշ%d}1 +L&wUeLTW@à~@8L&yqy3Hfvtaؾ.)j͛4K6zL\' 'Ϟo;G_1NvTQcoOJ=N_2;|vHEJ^ϰʻĩ2Ƌ"Tm[r+ዟ 7BP( Qb bJHzu͜i5xy seP<v\/̘,l.8?";qؼ8SM՜]/yFF4r`)|kl%;7yyƖjgYcy0D DP3 9VCYRi&FP( BQ0t><II]R骚 r^M0wBm_yvPw{ϽΟϝNKxvvĆ9:45Sb࿮TZq>8aj <'n-p6y[m9೽3Z sFc[5nԌbCⒸbX̄Cyl?( BX.$%bbѷ. MwdQ;,/jZ3k]'>ypCz <61k^クmWm[c {8v{M]P6M032p&im 1u`ofyܶF1: !Ԕb<hs 9ۙ E3%' BP(Y՛'bSfNܕ I|b)#@`Mt 9[M7mPq^6zNganalyssi>՜-^s"&xL0GB=' qoa!]g?{}ӘINZ 1Ydt#V#b^pN}r pˈ}'{_ۻtŝLLn5qDF@Thbfhc41ct7B(44`MP\BFEٺv5w{]]rosg~fтUs7}P%g߷/sM 듷ˏWxY+8gx)1̼ڒvlE]0waAKB4S(IP"G+(ÅIOW!/O7tf*I{FRe> :_C2$~ӵMP58WYO熼~!Kpsiڎ̱k 1W_z%-{o,~+&n*׏K_]#׹Wt66o6:t=9e>c}q롈0R40RM"K* qsZit'5'V>(6.S `O 31.Q&ujYww܊K/h(%ľ{$U%{usEZvµ%kLa}ۺx}s;bs3cekkin2u;:W6u ͞g'2Bà8K XJUƢx7˫sIRHOڟ!`aZݻ$8WEH~OF&( !h,DmK΍zڢyHr޻k1leuE\x///pg/5=qG=I'3j<Ԯߗ$|S긭F1Gep '0CDkr̾8/и!G]Z4IF5i?$0rt|$(wNU7@]_05gyb9Ġbeڞys[⏴[ٶmmՆy_5/Rz썖6x^U cCOU4qn?\gӕRZzĵО\Q$Д|ɇ(l E\k.(Vzt>M4㊼ şluVIO3Th/zA(Nhl"Xp*x虋WSY&yf(Ia]GA΁g/?p~7/z4m)}y;ߕ5WW9CM'uqKi֙/7ܽBkVNjTQS<2NE8ֶaWŦSl!R!19wj159/-|_$i-e~usi{!mǁYy '~7 m<|Gg9UqW:4|'VOıI ! .0"(c(v;-m;9LžeeƑ^54F"ibK;G"m#K(}C]&Գ[w_QIEYHզrj~"p#'0BĐ0Hdi/5/<FØP5)#1"H>`ĹJr겖L?K+$)3NH HƔ>nDObb$0,ܣ~)[_>}{-7("s"lj +a~JyM`SomY`=a/ySR d( lk*1$1TMbZ~d, Kq#]7kc ]i\w[BF[ "4˨fhHB[I8-,miK}_kӼ]8r#ђmeY_!Ѵҍ$;*Jڎ\d#LtK>$1<"}ӕcȱc \\)UJtۼJVQdXe,JaicXeyF>z}Hme59ZVVVojHiuw,/_k&eHbx<>ifz6A`'o[kgK06..iN0RMUN|UMݑ YaTx),HxdabIA;#nշgW6yוsZ֔V9Z-)V_śhl+朿^ /,ܧBn[ɇ$'O'eDh;_ cO26.-$M)fwJ;etZglZ)n:f9ZVdhW͟bnN2ݯt\_٠(aFpr4\CŃ$y|tkH Һ jha£ }խx7_Z[VI*q'u%-Uܤ^-jNk^adX-@]d?M67tFϑ̨"/][>TB0=SK,qK1A3IkOg>\jr{b-Z'YIYP)k{@&Y%bOѕdnH/ukhujhk9LHn\ȉ~KdYM^z`M;,+ؠ36SMKM &2SSL :+Ҙ]Ԟ]awA %e:: >BObOߛWgi9B83:vZEBΝΓԟ<չçz-O0jaCՂi,s()$1?O)P$Goiud$> endobj 43 0 obj <> stream xW[O0~G?)ݖ 6Em=T=hXiqz Ds`N|BYAIգk`T;9&Y,ߍ"} ŏGי(+ѳbx$G;]ZDمH-/_!Vݪ} )sSD)A8U'7m2 b -ٻdA?lhB B/"0R}ԙjMd2lt*3tߓMB|>B:#ջjӏMdر{F{c0QPF6T(Jm d?td'$e3İtilS⿛ ς.`^x'dŞ#kV F,+A7ɳT[uU=\}-[sMB[iV\`5i>w}rʉ-$"Kq^,$R~g$˞6v3/."Iy{b,ykb\lKAy|*e%!={a5MVe]]ZJZ3~Enu\7?#Xb endstream endobj 85 0 obj <> stream x]Mj0 >dM),C,rnB6}Y=uw'Ǹ-€'UWM{Wn;$;j".78<0o=Mpk8#%TۂQjf]cDi; "©o.XdCjyj0ګaq}sq߻+);(ArOx[S 1So& endstream endobj 86 0 obj <> stream x||T;lzۄ$,a7,B'ɒ!RR6BD(V WP7 J^@^}&yygr̙U$(U}0<}d[iq3nkdv~L[LPqm-?Oa Q cF>u]GKYp0ڽ<=Tp OsS {ITa2zT|Rjhh{T-~ wWmӵzET ([qT_ib;24r_Gзa}_"?w?/|SqC9G|G{ҋS4vwmZ yFyS7:_|Lڎе;/|mw9.텣TQk|>TS#w6:QjH!wd2ԽCԻCo*;Q,m3jzmV+GE5Um"]/fRi ~n Ϩ:gp.hkj^M F=hie4PO  Gj7RObP_Q-kSkbr-mJ ^şm~3=q{LO]/b=BX\ǵy7\{iDR4)` X,` Xi3_E9sQ)?k̀,` X,`?av {,` X,` X瘶aH.QG$?E@.0pIqH X,` XѕWi|VT&F)Ҡ;97q4JMh-崂6ҽӧi/D Ӟ>LIO2 epʈQ)Y)cma6-׶vŎ~5߀vlԃzQ: Top;|a;S G;iʶmO9<tރHLmMva.ϣ4mPۀopoU+w{D|r o訣sR[߷&*EQWwn}=^[;{G'}_J&8JN\ʣBJ4Sh"FE&zɢ\sEX$2J\ .KuCEѤLb)l 1LS)-+2E!F/9ەŬɍkcaFr~'q{;v,\c7f^:L~ Td|vҩdvlS/+?д;Ak.9m ϛ;gv]mMլ3O+/KK&O8dqe>e3 ѯoz4G{wkR|9&*"<,4$8Ȥk6oZהf7L+l?Va]҅uǔtqIlE6˹v[(/@ϵټ{ =Ц4#Dj*jڼ–_69"Z"s9}ө%<2˾E- ѢQhl֫;*klKU+{j]wTEvLiUX<jhL-8lسG!Ìe$e bh_B ;r,]VgI-Ke;I,>9b8'n]ҲCmy:xT :&0j9Ne\41\.&ټ4x\=rlr[Xb/,*wLNy)*wZm5cc T]t|--A9y'9*=UozK(EV`cWjolmkjnqUul/ixFY{VYVȶPf#F-vq~QK_Rn&_iB˩.k ˮ@~;핵]'OеF|tט͒gZۘKL*ynNDls\mx3x{ҪTU%H6VWZ$Tq0,K@feF]¡FT㝬IӜ^s&2EqGS.TYdmW+oQ@V1!umC-rǔhiP&Ygej[{]? ~ & ? ~M4(êx$(kOR.P4 } y# vְ$17\%Ql%8KJRbg*B3XJ,SQ%*qXB%(Q|%)1W9JVNZ%jVJJ%*L%f(1]iJ+QGJLQ­D%J+Qd%&)1Q JD(PbcW"O\%rVb.%)JRb#DÔ%+1HJ PJSJ8Do%z)S4%JP®Dw%R)aU)JtU¢D]HRJ$(D'%┈U¬DJD)DJ)DJ)aRBWBSB(A~!ڔ8A%~SW%(O%~QJ~%)?*+*W=J|J|ėJ|J]ϔحߔT]J|J|ćJ|JĻJJěJJīJN%^V%%^T%W9%U%V)%ēJ<%W1%U%V!%+Ѫ6%T%*E -Jx_WJlR%JܥĝJܡJܦĭJܢF%nV&%nT%W:%U%V*%TbW(q)q(q땸H hV%WbkX:u#ԱGcP=B{:u#ԱGcP=B{:uKP?B:u#GP?B:u#GP?B:u#GP?B:u#GP=B{:u#iGӎPN;Bv:툜-Rj:Sg5q,վnUZt& 3|)c@})9ә15r^2-ailbEL zyyLs0furiL7Sә131y2Mar32031Mf4iөLL}P8eey0}Ώ>d}.ezy*m_)dL3*yi';_fzELϱYgfz\IN=q{Qv>0CLۙZ6N=V-,ϗ8 e>{63mbǗZttL1t F9MF8z똮e+\ͩdyWp˙.K.ai=E\BN53]t>:J_Boc#?5N෢oFY^~-i}x؉{)jE~.j٨gXm} uxOO><<y%և#ZlnZm?<hgXXa7bus*릈{wwwwD unoo&GZĺ+ w]>zI$᳭^~ugZsM75rr޴JD*\uM>X _^>s 7~H[Ku(MnSc|cCQljШhk#KK7-qӒKxFzZڶcK|k(siEś-pCfv4]YTάrWfVgep4===mS,㞊S2KM"w"̉O,t=>s`8|wO]]m]uĮ YDv˲DeEI&kcI]Ģ.guJJꝞΟts~hN% rlJ e05ў b Zw b-& 3HE"?*? "!.Rgak(zC'Oyu{|EˌHYR )%qcJvYIjmR9g.m\N] _1k11"&-FsŠ1hM^ڢuWa1Q(M^ڢDWv>voooo;ggOO;ǁǀGG@+ xx l|@ 6{wwwwkk+ e%z"B8XP͘&/ֿX_` /ֿX_` /{ { { { { { { { _` /־Xk_` }/}-]`&-i]q_Ly8}@Ut.Եof:Cg-H}S'm{ E\T'툧1o]f>GF(uxtPA5~:ftATOțkRP ۋZD%@ ?S24#Hg9A+LZI J/dz991bKܵut>]pU3]H>_LP?*u)~.?yffAɔ@~i;}ՉR 7.m}ᑒJᦿQh`7MWњL I)%Gi]rK9FK CА^òu?$6%!1%.44.%1!%6A~ 5T=x5ᡚ)8[R>#S t2":cCCb#{N?65!c鴷0FyN=ھi["JCr5ʸFWW/bB{c_dDdR{xH4ER9RnGƥǹܔ7|xFƌB2;h@;W7to}$p'9;SOգu{ߦ!v=*)̴N)*|.=$G'OID01aQahK1y3IFNʤȹu%[b#/Q$EbLꕜB~ p,. pCMm;AO[P?GH!Y36F"{0 Rڛe"cƧƔ|Bpr'蹯!2zsQG,,pfMiCbN.Xr:&a͜T}Z:Y5lg^&g=SrFxFYevV,{SdP77^+tgE9o,:|L]6IdP*t_â _Kl>o<]淟Œ&-ZEN%CLϖ!atGMLSN G9;cirkԂB],X%JzyCڷQ]K4f4z_,˶l/#?"b;C# $)-BN[rzip -;7=kK8~Pr3$P'MF{ֿ{5.FER1$GvL=8}C׌6i>۵,<sClg?*F7DɨQQQ>F)sh0NtEiC &xYh/?55u̡pcD Hv 8a)1!d/?CA?C(aie5WwV5ch|RL=AT=Uz\GX 82L- 8W `=ҞpӨn'j_oUQ`~) "w+D*yH.9}q% 6 H8c9l! )Rg-^(@_][uaߥ蜾JK`K6t$5?Qf*N#x, oRXb3QѬ}o=~ݬ݌&ؓv#  @$laޖ1m1J9 ")'R".`Wze*2V%%mHdMzS쌆B F>SD}o4%8Xa>3Hztd]sm伟 jm1߹6LoJ 4||zSٻ i .1%jX0"|y̽3*TR96!R3Ub܇䚍*ħ,D'Rox~yg6wg>zWwXdWJGZ?=O|o߽w櫟sh?B,ujejejżՊy!l X=>ٌnH jLOw2ʖ}b|H [K?*FЅ*q!ʉ[^9o׆76>rU{d2-ɑm sg*eP: &,! [3k3k3{3DK3@b yE"@^ 3k9@qQuyFmCneni õ":/tfY֊.J֒IjJfV!DZ6΀YGtl(W.5Pڴ|)ˮpdR';f\N}d&tW%y~"-ۗumi5?=[m0h[<`<9 lu9^)0οy]81w)KkQ-Ɠ`"$þ.~\?@TiƠ#.`w(fŚ):ߌ7:N-9E~`Xt ͵p9.QcpW. ; 4ӐkXI8]Oumlc ;s-SɱWmKme|r]PSѺDviE39m)ɼ?hY=&:X6H5է:Wy :.@yEBjq%a_M˵͒oh erp0Z1V?V]G{iϲW5]c<m_lӃ @{|i69]/7b[?3H`knC,|Wu`0JJTͲa_L>KeO7/`e*`w {;V 1גUL`,,Es@gkh{)7|v"y YߐkU;]Ub w1f0 ͪ(jd-bK/ם-u1E54cvJ ^;qp53Xfzy5pH4%wlw"6!: #̘ӢVu{/D q&O' 3BSHY-z@YDp!pmzUᦋp]mΠ釦m|Qvx3sa.R_%Y 4AU+ {QW Z? p,+,E]U@#|9x0 Ex[goy,-6L-5Q&Ohkj Z/ 6Xu'2)(璦t\RV#!/l^y^XT'U<,-m& wRJۤ! pLt.v $s-:{ɽgP:bKz:i #nniVWe\E_ߗP I\4kVZmZrQ;A5Wxr$Nngwy_#p=;Ã@.x2F;W>>VjD%0r7wm* bDy?6TsܨiBECQ8ƒ#TEl?ڽ}?}^p w7{`^o8{{W? +ۺw|xAt7c?^<2+6xȆ|L}xLR[f-"PEAV%aQ.d=Xt/;e#ݝKҶAqUlR5Ⱥ[K= tW h|s~ ʱ5/:<)QGα gNf^{d kv(YA8=}ƒMM -i}93\kZj;2![8g@wx۲=W vYW|iگH;Pj ٗj z.7ZD4mmFe/V̲O'aNL6u ߗ.dF/Q,e6 |T]06QHsy]52-gK݀{:΋t&*~Dz7w|r:BqG)Gxm\ |!`wx`&yƳL?Bq@ @4h Q_wPwAJ }K'/>*Hmg<~Uwc{`/޻fjM_UڽUc w uboͺ5}x4wHt3{OcEbT.qk.YFoX:=NKE﬍V&`\p|u|V30 Hq &qhH≓> pTB@,$uDh(֘N/Mk7~à Ӵ'(&ٮymdu-Lu` qk"vUi#[|΀z֧F=>+[[R_Q8 ӫsO{G 7tb Wa6m~-Qyf*o@ FUDKQhHe$V5M\Eim_R)c iOYhA'h []zMZ ]VpM®&Z0'VI`6H%3YT15V DבH%v0%4tBYLz;ӍŭQzq/[P5Nb$M1/bժҙCN_4Յ?*SehU2(xdĨU$l~Lv;[g hg1_j\Hd1b |I֏L1 BDuZ)@;`y 4SEd #Z-TՌ/>"}mc:wG1}!q+j1=&WpMbq0='3(Vn_wil ,5t埆FbpkUVZVe~ͼyk ڞkjA<eibO4wYfu'n#ƨZ ƹ?ZB\sL;Yxh|}zkKX#SWhCk vKl|{vo$ Op 8qTȑ/1҂f2x}6T6$ KBh(%͐LqPk2Q/Yp*>:Ʈ]65j¤7FW9 N'2qWu?snOM_C )<:}O? ~ a>~QoG#0݈PV|42Bђktι_GzXB T 4 SSL)j_ hj8seaxG$8 \t> ? *>|<3ڜ_pa?js~ZGCt {^/Y u)m^? ys/gD'3xNteZGZAqhl˼k074 : br 0Be(8,%_;u @m>cA4LM ]JW ȃāJsz?/&BݩK+ʲY!d 0 7~|C˪^Yu}_# L A "g(6Vla bDz Nurg~]_&6#6"kk}30z~?Dk92JFZͽW 4:g^ZgbƵ\kߔIPʻpCX@Hq@Kis m?Xu|h#hw2k0ƷZ1hYg0pZ$is EƅYv&9خ#$F|KuF.sd t]1nF!ffOۿZꡔ=o^ZgzQi"Yŕa2ɽp4wGxp|c6N!+\.5:y \^!fY^BU>R|@QR+ڊNaZJ)*?5vf[?7rD{v[&i;tM]Fӻ5ݱZN"L<< XQW6޽}vUh)FeA^GW \ Wۚ7 kˋHPnR3.s\m#)r޼F̶☪kVEH?8V6I1u+p'SɘiJ֤m+ja*j%HN[,׿<鋓߳KGWOtlK_I(00u`UiZhY? }3שnLc;Hn y~˦va{&,E綃}}];_?uN PMC*u.W;w! (qAFDR RNSl?#y ^޼tZ (ˉ: ^1%Jh"%승@x ,S8DXUYnΏ T\*V6CT"9YB,!i{SxE QۢAg,Jg?u2Ʃ'di.Ѧ25򂏆zAFfhȼF 5cRs}}0Ϸ2h tɯgzCD>t+d$T mPp^%73`t"/)F[Z,w$>Ve@dIw3P7.StVp%A* 7.9]+kױe\Q-x_P`MCd,|Xx%%/COClAc8%8x4/a?m_Wu%˯}߫T֒dUiq/$Y` ۖ &$, tB 6s&d$mHf2N&$dk8H85 tCy~in˪RU꿻{ˊ&bS}{ &rX0膧 !JcۏuSWs/oSr Ԟ${|4;Οd>_Dylm: p- Ps1j(W au-ѽRp{N2|9_g[w@U,Րdr|mKãˍ\ ŖfxJ@bĶw'JP;3yД C݈=C”ȁS>HMl3^]:_ 4Zo ")΂]muVW\J2ߒڰ,@\Ks :qGJ5Diq,T>;m>;Q`tsv q.^@H\SC2*j[=/\uY0.`HX3z@\ïOѡPQG!g29Liz ]9$6mJ}Rbl m];RH+P=LZN a&bC+  HjqR)*pL lc=\r{݀_V1E[E#tZ+)e@ x3#΍}&f?H?aS?P (fRIopͻ!G,Vm0REnfxx73W0HlW[8}(vnfr:G,#YZ0&+W`5꟯ pcbo^1'7vj1*ӥG}1/lP8n nٓx1CY@dv'*:ԒYm<ϔv;W Z!u Y8=<`Nc YD;}IsO׏wNQǘ}Ş4hGڂ\h㟆=N ?8=!yU@aգ.GW w5P`BvG`xDHRYwʣ{2WSċc5F Q E*J$7gK׀r82`''l f!"  "s #D %x.s3[z{+̖3Q`5iHXYwl8I2ʿ&"=uL3ή֜I" O Ar Fm-@SZ)7NI\vfk[Q**eŪn ȀǰW8{;CI&0}>p|?:K taalܯ>]V9R)g43T묅ConEoZխ!w+O}gnpiζ|h$,oo=ir.#6Kn 8m@ Gm-u`k[` ERxXZ=}yZd 6窔*Z6a"Jlb.gʦztv52V.,-8x[qU y\ϱD\EblU!ߕD ;r6ț+;r6_/3]5D2%w[f`8K: )YLz_5^cdQcUwo٣H.Bךz_0uۧ.ϴcPzx,;KL;K(ӌ:\,r%eFpb AD?я2,sHԻ9z̵6a BVCC[opnѡs:/{@Sp4g%\ z/@VyoɳN `ʖp5~2T҇B*3>A}8̟_#0Jn#t}^^X>jiClۉHB[ ̔7J{w`@ϑϯ^eϒFgkN.Kd0C2 [Ҁ?R2S֞lRLG_1Ӄf 5 l]|f{Ee$#PFte ^ȦF⒂ (ۛ,#isqx5\amʌn+ln.2`MCh╍"*|]m*Eӛ06m !}O>}C/~PT,o^8*Z\bh{tDu`z.ҭT3%Wmד@!ˋPN,pt)T2jFry(]#ܞh p*~h#O^3>Ee0 Ǿu 4֬B =Wbsa* E ; &ˋv}z4v8<ˍ{.]d PR,7 e,dx7/߫W1k(fOMl ΢m {sYqC$L .V&vFsb;.<zHF0 Ȉ=Hufjax9L%Ԑ)&^zMR5&3\`ª|RZb!&0DDooM2PJ"qHqO`cy4Gɡa$*(~`7K#DliZ+%]!Cޝ!C% 5Bň?^z ² dA ŇtK،~.q"P/)v,ܑx2歚!E% EpM,\@$/&zr}<_ʦL!G+hi&ҺǷ$J)sc[nApΡUå^+,PX}ԺX5n};с=46u \Ɉ.]}+ǧ >!XSX];Jt*A$s[ PQp!ed(#4 gϊG]҈s=~ Of @քzU1#7 Q9 *_]"=4y<%P u<@Ӎ/Ok`4 T"EF"{[o GyEsTI$=imkKװdڠR0n/|Uw}icD*1S-'pXwAɷ^!$?!eB)^VM( Z5zqkV& ;կ@ΟrSY0ZjꬕaCea8(ikyo}7 0j]\f9ZC6 IB}ۋD:`~o;\}cLe푉 #Jfb躴+=0Cd2 )f& ͢aitV LPx A`50 hPi2"ask〼<‰B_F>ŁRaM$A`7P0^_? @\&ȹ̠ORL2d~'   0C;uɄHyBN/q7I.]7櫳u3. ,(5Ϊ\@2? uk64>^'/[RKDf$)9II$"')) )@"H@ݯ%0k(pgjLI&}=gsÌ ZP6뽠έ{T9֣b'Ã<,GF/ī/uFk%'RV'=٥MFAHT t 0eXhiڮ'ðPTK|Zա1މ,QX ؼ7~"3a/Kn]紜l&iTlQQ[Em G85* bi KӿOj\sbc GY4c7;G֬at\K%uycc=OyoقSӱ1V V4pn+&StЙpiCe2{l'ԴFCQ+RS36?]2`&Rv&`?=~:*8 u h;r,) J,#xs_\t i-%;foo/}97 3J<ɷ J:hWk``~|*ٴ$(,e: -Kru_`u ml,%Vv9 (ЊVL,O}:9v9XUR2L++`D%+Cc(m>;yd,$U JQ2uMntxSjBX'W >6PIo+z!E \~p; Ye^ ;~fn ,c2¨X%ړi_9 frL&#=PvHh,: gdŜZ"}KlGx |+0jM'Yp$ \;Ip/[)NxŝuhK 4P.RJ6uN)Ƒ`GDH0=!Atjeת# XyP:$'Y,fуP,WѷtN{Ip )"Rw૒fFsV8_gE(ƌZ R=uc̓tvWrANo3vNM3@66 $?Ӧ-Ҫ7)abn: z4GJ)l6lZgt6Թ%O v$^.!] sbVBuDH-(IY1FȖ-;!t˖%ʄ6 G*Be{4 ja*)xIB @R2eK0u*hXѺ~XX{ }x҅iŽwr9,[:JȦt߼g&K <\Lx<׃W=4gj n#V` 9.DǩۡDyHђqBtn30mVq3.:MSɥ tN\:錟x>;dje%)2U :V5u`ZUX NZ{œyA@Wȭ`U*jGyN% 2vqjWlH(. v^R{vpwǏXE32` ,zuxkHQ\B8{[0DMT0Y:Y30`s{0h[mL;3_657Ԟθ"vUhtOp!CSi1Lt!d rTCFgXQF:hJ&Ԯ`%&s-Ҭ trŒb$t՘A6~@T(_Qd14S/'oc&竁hjtbC 'oOSmXꨴ%9x,epy@(>t,P; 3o9z2@U^f_GnHH㎒-,D$hiF~dieRbo[%r V1D<*\ৰ弯צ_·ܘ:qsD{ /(O|0ЏPGŝf[[¹ ֗˂+]ZJ@яΕaF fWϵhX"Pq{/UKIJ&Qc]@bZ SyO{ԡ'ey`zɡMөIM鍺@ZchV5JAMi WK8"R"H=mJd(9%!:ʈhYn t4"ȱ&[}g&~C uն9CQ LR|띔YjfI+*9A-&\JuN#vٰii*%oiUF_v/U{PPgE l؛Hq|2mF%[yuTQyLr##@+uoW)9nP/a_؟gccrqǝA'g%A/[o~a!酣U:iỲb8,({scWtVaB' O/@iyhshTI%8R;F oΦ C4Upi5}5Ѫg{/|BtB}|Γ@pcN]xEf0ZN+ރ^(zh{NC1v%jfZ4+9kJC {F*ňs1n%sgиL3:tTM~5ָ G Ѫ S15ַӹ8z;- 8*T&୪B܋h(Pj(&>n>OD)&tth7Y.}~'ޝ{D)&"4Cam4Z1lܜ^ޏY3~BDt,Zp9|_1(\QKK,3pRpC-qD:EFkUGE9yvh^]Z-Ù+zj]p QSZgq8PQ^= Ey;;Kqags9~9cte9{8J=%]mPڞZe*וuI_*m`fO;S%_$&a{&=EeRs,l%]nтh 4>gTՖUbV%.WТF*/ Z_➐al!0r/GJrY¦7bw:˽X[O dlϗ|j.h QByJ,ۼ"VKE{VvGF浜$VQlfsh4 Ч_bClbLv{  ~7s[\sB= tBW ԉ7iP0c.ZLݮp姴F3uQ >n0Ng/_PviUN6dOk>K7*<<!dV!EV=r|g3t\yeprx- zrtZZk9^# %>RNi@`p2ޭt.w")hj++mh7g@#&UD]Y h39)638@P(F[ ұP:zclPs`'7_о8FShh Z?}!рam,+sK\ff Bf e1>,1CQ逍Q8):?aݳ:~/rgiQ;ǎL#0Q$) @ͪI,~ +4x' (R60[Tp%x7H5*Il9 R ,*]xF?:Ϣ?$fuErk30Vc ? {o* >Ǯ2\~Af"2xY\2S[&K_z4Dzy\kHhM#Z&pR]zһe7L@7Utt<0W Br賦T:XMdr*468]@JE7>kHfA7FGdoʠRIgs9cshL!,-!,Cq('@zג+uS87(ı&=)m*Fʆ"UО11 y1h1iϤMs~:z ?vF|Y @Z^Qprrr?<<oBF$Zlv`%mr٪eXK_D2b3K41=6ko8Emg@6#{ ==w0NoxǁD*V_H^ )WudM:_f<#Ch=[U vjr7#`3i'r'=LI(L6LAܨ"EޫnG5rfUr6xIiږ+7R?'Z8+8=ΩN"U_ 11(?FNX g#A #ȶG6`zYwLn!:*5\Sp>Y[R:.HG3/[sݱ{Ȥg$AEƫ[`,x'SBQz>fX6?T^ [^ϊ4g?jW c L T;e~>g3Z;<ՊM:ql\?5# *#7/[VHiv&5qmO_] 7e=^}͚}kz b/}ux𾗮J/ݸ+{]nz\ L_1'^ &r 8ٴ\ Zp1䖅hJ4FIr>(bh)u E NhF@4[x-\-+:# ypRoؗZw k*U\-5;FETaS,b7Mgu\\=frիWfk #wƧu`0liD/6 j5]^/5bΠcD.CŅ8RBN`Rjw)uu|Zi-ҝg^-K򃣷>\jz"25[LHy#OK!γ)l+ΠܨfEaRO@Mt KJ狚 =8.Pc!bPQ% (HeAGc8?OWԿJX}֪Hn7 .Ûeb՟ds(|'QX-`֖ڏ#ZwEN$d,/*D$X>`t0)-%BYvFyw4x!ζ=->=5hHڙWfH]̩3A6xV4pq7:&v0BhB*਄8U,g^: 1zTR+gBH_6B'V?R$.OQ"R*\ԞJQCPZ:ش&:qp9fm^><xӓS%+>xɭ%3707(W'&BL_I&v޷1 `r[Yew B̢T8P@XxXHk_(Ƞ,*gWj%14:zn2_`v oUz5 s- V^N&3  j e>fȭC$T|! v,#UP`'JG g%,%OAQ* :.=x9n ,9 HҸբJnbK㖮*ɨIޟ:Ѕ՗J93LJXwD ½*S^a_ ]D\콜}6cNt NYwZe_pVDh> ,;#eH@@`? 0@/΂J P<&r8V}Xj]R_^uX!6pKCkJwn3.a}ƀf_GdLo$Y㭼`Uŕٴ9.$.Y0}b=h$:D[hM-J "v(3vED EQ ZNAP7tͥ:> A"ZTXրmb>!9)}=}Oc`Q7@j!#4. 3@R@;pH}wez`4fjx6nmY_㞡3m&ǒX}tC.XQR^}<,}<9UaM( lQ@P *5_**]XƏ*4L"7c۹D@{H, (G֜m9oC d.KB%{C]TѦ2rdDr_/.B| 1DTAJSsc<}Pq |nD.zSzΖF{cR l獏"\Wo>R7U0g$'o*VA4cO#|=@<;}O\h:x}&>h-nW|On'wӻ[_o;<%; S\C#$Oxo V!{pkӷy6|e/-,h neT3jIШ>bDM0xڬC0~9L_չyпCDҀpĢǷTD7zږs/\ ľ-_[םJިH{ucT^ aPމ X⭂贘t w{efJv8X5Ga@o~Ru,G{Z(G˖jݛ͉(JLδ0cmKgh1:kjjz[7z{nl{Dh,fK$&j%^S1xe65/z{!U#>wao vIӌ1@Q\ˁ.0;\BD݅\F0LbKLO+i4})AݿKbn}qˎJ{# Hu 麢ӏIuС5ő{WͬiO:U5=5ɭƆ,-Wmj9ѰFx]v`V<w5l}贆1cc bܘQVkmiWCY.iK CȰtm6M%O[cd`&<&\{ }}o=}wo 7'0J@aN;y13"}S%yc^T e,!kҠ  ,x/-# 5,xx2 UNz6 Y X8juxeGqi?Oe7?loUM 0' nBK=We$k7fIM2|Npc]so(Ku~=55Pt~Bs^/2t~8ަsi i3K*J?+ͫJJ۰91*rW*K|P1xNrZvgs] V+hPg5u"%7j&ǰPHyޅZ_Ɂw,>> q@#2h·dC/(Oi{1\wh{R |hg- cww\q{&m-E8hm/Ko[ncXR[l Z[)?LZ{zBwO93fì6hVZ#XB "H$8| dIdYpkrg3^UuJx{twulS:9`J^ơ/xₖXFoAٶ {CEWԾp(Q3ݚ[Q]5tqY! 2trZ@TTξ {V%W39?regN}BbX3l%3 1<(>R"xV(|O_wɽ:p<O3a|WɃwwx{?vCˣzrVOq'*Z@/F/O`VDZ\w_C8jNXvI䂫u3MuR]kn[>Sdh .N#z,&ժ̪/_!m~6V!Gi]~u%RJ[ dg_w\MҔgc;}V]} zEc,-ճS}`/l-<>^oXNL>A,kA|W[ rfy6dT*ڄߖ)㿿` -$0?l6Ծ l?^}*y [kgߘ{6Ӟ`?o4"p0歽IڻWnrJucogG.N~&&q`~RTѥEnm:k}m8Pp>NOS ׽}^GTabg_O6q6je9$Ee nZUaG?nspxjBiր+(P\N8泋/=OjvѦ_d@]H+>mLg8,gk1/5UAsBUc=fw6ÿW TBdj.ԩ}'[;Xlp;NQ}X%- ֽ~>Z{CS>ZF" XL tzkFhH$PN2glI2r,bn)}Jbx|Gdc|C*RnVtEǐ/DD  2 7`/QyՍ`!gRR`g0Y3?8x[;;-̓;c6zl;뿾wq}֧_zPn"f{!\ !A"Vǽc@z!Y@ q%KY\!y\eWHW6cCl,d% -)gW4 :*DpA\:MLM9Gڞ LB¢Ɵ!ӼՈA /*;8i!i|GY}7:E.bc,"om]s0z3ԗye$ zi!)sH0s98T ڌ`D`1b=c'nD-p02u@D +l+#GmǗQjr'(Ie*a ?I2pӓㆶ)  XBթ$_| IؾxWѧ\--fN._e%vİSF)EW(hUSCY@^*+4@ a8Aϰ b3IB4@ ,5Ȳ4e  1W:-5D4ES"J,$IPDa7'I*Y {Vh%JR!KS85gc6r4ɉ'i/6zejDqZs Geڢai vR Tލ:: nd ($rQs̑x Bojȝr_-$_VF@ägfSE߫8Nq"ޏ,|LmcWd0HAmtМ&ˊ&c#d XF9(c7!ᆤ\ǿa߃S:V"j%*D͢QWhxQ:WAC+άDʬ|'FB}i9j~E4[T dg \y4@"(Ri HBo686>TBopՔ%r*ы5=ޒ{L::>ȭmeV4x-.<߭TN$'IjT4D߀%ApGXVJFɭF)遭R&_ OүR,Kd%,:n*%yjM \GCWJ֑`RXbPJUĈJ0N&#ˏ מ>W˦˦i]w-Y|X$6E5Fg/KZuֻ֮k{{ֻ6/nGWdp`|. ;'#X;'\W(;e宲cHߚܱM_{ k 8jXZMvj\!i=cAc H'9Ln4m5Cw2O89謯q稫5uM.>f} oS窰RL4r+,r꙯;L.|ZNM `{mW^:;gDQbέ42&I-XE`7ֹ`m}qf5έ*@kh` JqnAÉ18Kk㡳Xa(<&.$V !-l֓}ڳx9-{}33!nsW$U#xK.Oλ| 3Ň4 {srA-᲎Pw$EsMHNXen]$I Ve0I-ODxUN7F[o8wg'7$U ˒'ɾvwp]z**暋mbjC 폡 INW+A}ż#iaφ쮘7>:\_G `7ZCʪk1F 9!,"![Usi^!CԕgXdF`vc{ht7ԕFHf?%(`O)©T䡱ǻ3ў͔]hC5mʆޠ. h^^kQI[yxˋp䤉e?m?x٘88Z Q[EPkHlpK׷3ghꇺ+]?c7F;cR@3v|%%1.3ǑOt׃tS6n 7_hVV W?tNêEc M"ӌ""p~RӛE]%2D16WCL,gT; dT;@u@z6HTUUDh֣z/R#1q@z +QţUXg? fuFN@>YpޣoNJQ\;GK=AHYjY ܼCjAwunG.dMΙ{GSc ]_chh=48jPƘ_W|W*,>덃^A0yt V cxf7WM7PZp/eWu-mtMh!c[Ű鴮DG" hW, #=\lsn ]@L7Һi <θpѭ%p~ri FVUH3QPqF8-cdg؝*G D}@va,i \Dz*KMC F/GP'ij\@ ba`g? it,F>{V `re$[4]Fl*0kmGߺNgꕦd!W;r #Mu.(Xotx{\'r'S ɱ=C7mh5,+Si4jO?b0yKùRQg_qDr9bjxIA/W8L`8bE,}m#U|o $ߧX#q!*@~( Po LCEQnbÆaa!z&8D8'+T -FAsC~n VzmF~$rEi mh&Yf̑֠'08kz{V:;~3ў+uNQ5t|lVp?$+ W6o4tgݶd{8]TD\F%87rNDxeި7jHZri&O& мe8YJKylvrVi(-JɦӢ:Es/OT3#ѥQHPUNNQ6c >jfoAT(|{ QV$F{I}}bx |3bJ@R^l 3Uq[lrt~<`QC RSOj>埵wdSن6v:n7l;gcC:_`ŋ&w0P JIʌv9IY[#- Fcۺc)7+.ҕXXak?*4T B BR5a%p!Znb61XJ%+`^V]Tmڎkci[)I;8CTT}bh*VݳiN_7gӞkײU6e{u;w:V1,XbYBwDOݿs͒tkɚj"[6"DT$pTӴ@|Y)`T,Ѩʱ~_3zq}euxu:[,fDr\Z\@.@gq#b>b1~nVQ;uw\B!*_'Kз]?L <+->RMOD~[yݣl=dΜQBΛV˵ *Rj685bBENEB> ay{i+ 7ٓu`yD nf^0EŋۘezvHSI g&zBTqc'ij&:6D^0#8>=T{׋<`Y@h&7ʃ@N߂STzQ>o?QN/1 ~}&_r!\v2 qي `m;iJzhgsFێU'id lxCM.'zrjoQVh]F `9YJXFkᬬ+\Fp{:ѶD=-RшS.:'EJ#űfV02ӬqDvxy'-X$DX^ <9 r0bf9 Ψ`\4?7/hzl6VͪAj%e R'9Đ+/H@k'8VғT$b_ \#(I sR%4A#2< =yaB{ٔiY E |dJ䁅MD5:-@qyf=03I=PЌq1+WwxGkٞ;Kb}jmIԱPW>mmFga$*$,6s=Jyw"Eg;' e:CS혨/l|?Pf6o|e?u۝VYZn<|mҦVl}=п 1,\^8H:9&~Zyh9qO@"9$X{StRm[5O%12M4R`4?r6^74cXB̅cQp8Xq h>4& 3цĒi"gҦ`@:8՝X9`mD581MT3{dFUWK)`]2KaR3AsZWUផ͞aZPkӃbsmҲԼNeuY[˽[C}Valj炐 8J8u]J|J#k/EA <##_CS{~N~V{ Gel0wۦ,剡38#=MyLpB5ms2cr8 H_zU#F'A6-h3 g?^v0ct÷?+gJM0ïξC AMsE,zrzcla,93= C1 {OH퍉3gW1y,< {CY To<18m6E1d*R~jrMw.HpE&ks5j+i@YWlf5o7^tA*zYA7pUfQͷК̻wBF( ٌ"މ:(K-ŚpV|v瑇0ecy1;c~ެڸ~n-#έ#y.֗+~,'$ CH ?3B\#h=zN6]Vjcwk^lc4 y3 IFs+/_}k}}kaR޺zՑqfC իJn3yGZfՉ_ݴ*59=1mƂs2̒3s[RDN6f{ G|s]aa[Ò)516c{`Xyf%ZEC{b{asy^xTXbDniӺ}}εY JDDG"ʖƒ7U([)Y")<")k݊+2VlXwIq#Mk")j6N8dnw2ezC\ SqcO>=$lҒ*E\-+Wf,.DGDkv ,򜐲+aWsV/c.~/,ְ:5,]ǕrNJ3<#%%/,9bYF|Y%v=Ty]vSK*]DxxTdx۲*1!9?`ZJӜ' 7EKaiYx}=m|{Rܭ}0}ֻ@ ֓aU>b_O]wvnkq֤dvoK۴1 ]щiIQIx<B8ƙ/$ AsXηk)R,YScp )+=^wW}בV\av|؃,Fr9 r]DӅ')yruaYʼبڦج"yf#^@xK 4Xj^Š辎8!i6V:aY>~>J)=ɋ/DDžG 9=)'""ҳ[qsߴI׺ I^+>fʠ d [S2\NdX&5YT Ņ鶬*MK듓M*IssoUvdl"Uo OQk/es t,orZߴl_v ~-U{5)KN^WR"ۘi)޳$ⶕyek6.޺dDs-c :]>5><2а{}2s֖ĺݛ 7<4sDžU>.K;.HcǗZ2 "x}(!+ qƔ, Ƥ=;jZ:&22ujALDΤJ.;ήeʿFM=we";7=z/Rjn{wn˯uU2VrƍEU?W^U[\ZY7y/>yzX;Sϫ㎸+GXZ&ܷVK1*k+IV*۲s}ʪmM{˒1ryQ֒V؈pl _137LP%5y醍?/S&H ?#<$@1ǎMlcAl羜L=+.%{޸chq̡(Xw#YL𫬬Y+Sף;>LJ%;4yraoݽmA%$2W+ȷ.B]&|YB~`3=" $$?yKO$ /Ur4%K%"H]RUR zHexڔ_23v+F%[Y*e/7sY&o9,4Yxڻ?)^uͦD&Ŧmy/?dC$$i7KK 9NrqI6+|l4Av.rrb*K?_<y4Xvo3T7TwBKMM+SJCKR7$Ks# 6}9y[̘S槶lmkG46ȩ%i>ɫWGs.$!s&Nȏwumҕ]]zRt5&=e=y77wUoAoeצ]m}5˥?rٽk}csfxo}ㆈ-q'{9th{io<>걇o?f_9n~{m/LL4yx{&4M&|`=7x?IM^^7}7|q3s7}ّwfEJG#|û; #; 2 IHB俴}?C?1 ߻2y!$$! IHB_On.$! IHB$$ s{ퟻ;*߹ί_?wOK.=HVl IHB$$! IHBoti/<qaQ%**oGqT9 \P$s1@74yDXNLJxp{S;V9˥a̗4W~eM`:eq0Z/(/%BaF 30Z s Hh",'l&l%&Y#4QboU.LDQ>E_πyO÷92!Wgg "~6jCW^PNs 3{\+}x0AyL&ճ@0ЀFBa9a3a+4i摵>(Ӂ?С t+p8|*g ei ,GnC nF>ˍInn<PgFBa9a3a+QmYId%DVYId%DVYJGV:ґtd#+Y*VFBa9a3a+r@ʳdP"NI'tI'tI't;@#W !>xRyV&[leV&[leV&!!!!![z('Ʉcl@0@FBa9a3a+aoii ,s^yT!`rV~&yh$䡑<4FHC#yh$䡑<4FHC#yh$䡑<4FHC#yh$a'<|(Paʄ9 r8C8Kx"G8MR1@cVZ:hu p0A00C)0[y(N+gg G76AVd5AVd5AVd5AVd5AVh@%L#/ P P,R,RsoѾ1GsoѾ1G97h8 Fg0AyL@0gg P?/*6x W6ݨyx6Hh",'l&l%<\@7'%Baa2a72a4(d8Kx4*GՏ2P"hv eB 4 [ W m ,aY\b'Q Wn xP"&(O 3ρ2a4V piΣ>O`^CX o'0O^ (~u `6LCh@uDN [ ;Q'gp0L'LsAy{ ^ѫʛQÇFBa9a3a+a'<<\P0[7E%!kEm/z0z3zX1(9 <|+z^T̋XR4 *M cDI:V]U* ()U0VER")U,eڬrQԎay)U DSD8QZ(V-@avgdGjYQ!@TDoѬBLU0 2?cXUQ@TUDU/* )UPlYU#- $U0ٲ*XV @T ŲJưV R>"R>0Ko*7)YFo/*CEE*Jd[p[ [[썰[[[_q:!Å$BDѕH'}[ka-qiZ[MHkn-#99l\kG _ Gsv 6Z;6NqGI6υ'ߪ.. h(~0x=\x=_ʻ[%Kth$n_KqVIagk[Pݶm4U$_lI 2x/QsXeCҵ|«Q4kzIq̣4{ [Cl%^Ctvx;E?*jtFOq9q=e 5WZW>s-Qw zUFWWs o-\#5e'c+pՀ@[{2GP zSz7qML6r4G#F&.{zQc5k7.+=Y;UO{/"\f{W]E{ci`_U-_e_2}9/ZFfk.te1?CYLt0dfyvy\^w-^ik>2]6=a2ŶݶIcm)+;\#vluOF.)ٷEr1>*XVzFro{dG8.\gtح&=.jM9ln;jw{6تd&mCC!١C6mgC6-c. y,NFqۇa˘1%Oڽ7ud ڝ#p ^,C =&앇mmn{1S${,jG^8tlnhzl^#];Iyq+۝q `5,Gh`u"6Y,)CJU}N Yd8#c^`!Yd$`Luc66sX܁O]a.PRPfZ_z2d8(BNcjY O!(7].;^Y\<99iۙ^w-SVh47>pk&yƦdJˊu3"HV$=(`5n;^Bņ{np#Bݸ0QC>lgrn lڝVˉJ1 e歺PȻ[ՂO@u01 Jl &eh9{*TAX.0dca2Qc|9ؗP:Kɨ}eSl\v\֨.-rv  Z-؜Imn1#k{J!KeAk sMJFxѼ߅5XKllDmQldAܠ+6*BǍcp\v bs2R,Qڣ`Y<na1brz-~jwqYrS?YH nzϲr+ʍyaGsIh^nfmDȸyFibA[֩U ",Fۢ]vuGPW)E1MNLƮ#[>h!PeR* &lAeKF2V+E{3΃A۲k ͦxQLv(p\ZڮF-wvu2746ݸ.(=-=24j{vMrmnP$7wv5vw]yGg}s{\fD ! ̍l]-3{vMv6f;kzm]rgoWgGw#o.ҸGn;][jh^xEwt27-m kgumTּHnQHV4Z sG; E'`gn,k݌ E FuF,#Pa׽ݍK44ֶanfl#!۰w.&g`Em܃( =ᅚKwC1ddd{;)i-ܕ d.\QxN~c T?_*IRUL 2}תҮU?!FU_g^З D =Ұeq|q{Q$Ƈt'7}} ^uoxM>;l>>z7d?=?üw>[=~7~%?˿ۄ0~^H B~AOIaZgQA\vaB>! G~᳢C!zƒqqVxUG8#'| %Foi;bxJ +Vn/xF?.oωϋ_*P ,S4|>>a|||x|F4>׃jls|~|>>>GE'y?" > gs|873oϟϟx!'&U|V& >ocF)y7|>?O-3 >Sg,|^>)9>;>)||| >Td<kgZ-|Z8_?) g׃s |w/o 8|||E7+śTqF,DU{0<>ow/oχI<||'$'Ҥ )˻j9? 3|f>{'{+'D'S%ԣd >g3>|_/o综Kx|* >s |w/CQ$-| |g^1\CYC\ >7*Y >{|>? >>gxZſH)GT>g+Vyr>FY>|-^> >Os`qȍ)stϣ~ d{'yN^h]{|?1܄pEh1FD#D*6!D^0b(EDx!Q"EDH1U#>wǮj_w{3;9;ssJz^z3PZnԳ|܌zzG=?C=Sg.%ҔVv*G?eʮd#Qk[Ps.lB܀z'O/vHKbfsP֡]ž&sP{PӨ˨;gUA zzfSP[QcVVNB=#POT+WbqEus/)w)_:ƿ|5Sc 迿Ÿ7Uz֣MZ2uugg( |e)Ty]z3Pzs) \zn@=#.syM\B-ߵ6G-֦U4s 8܎z~z}'o?NO5 ֨ յnv74tAap۩:<0EÔ-+0fniiy[Whl'RUGGUJՋDs4TOa  E3Ntu*ݡ@εQiΰ(Щ)NGhr;~,LnÝ+8%sk2C!q`NgUCCQnJU&s+[3CWÎYFCs|LN}>8dN<팱)$sNaS\"f7n'SZY,7"v.V&U!r/dN8p~~0h^E~XhBF=BjV54;&t aV8!֟3nw `0v֜G=* n#"*.ā 1iHكqs ĄK6ӀtlJ0#n̖>M |3I'$ܹ6[?щTtbt^Q/cnlDLJtdz^^ܑRlH⎌$¥b,RblSK:C9rE0wӭ/OEЈk/K@RPMsKw*[T݉ҩe#5e w 4!Ba:uuR)"xnam|N<%@(/":݊ټ|=ϝ{;asāFQbM$XCeˡU8p<4'u(^Wު(8 ߰ ޺A=SF4cĠsgsiW#B  .O'F[#<[e8 ]k{хb/^E&_;3PܪX}?"[ދ!mh*7c~rq}5D.t+eD"J3h[C/T|X]UN4M i˭סzX`hViiiC{3ʤ[TAtw4 0ڈ:oc^<ϐ1vץxS`[pO<3뤹!@q~ ]z@n,(4%Xy[$-֜ޜސא'\\wx66sYW/({(7cU-5[z(-ֶĨ'?ȄC%7bKp)> b=ueM$(ǐ"!r'Tn`!BX?+xA֜Zs'UB 1Ob F҄HVS_b(3^_$zҮ3Ze Jm2pC oY iģZU1͐zs_!BPLk6aXbr~Wڢ[t1cO6ˌm4>E9c"$7ÊF7KUM7G4u3+IXDt-d=K3{B%B\7ݴ! ei*b)vTo0.Uu&\c%Pͭ;@Rf%H?ׄx{jhhg^hW a3"'y$:11 #q#V?>mmmzO}(HYwϣ|]bl6" fP]]]f>zQ2~M>^)1(1^ ">{udtOQmm[_oHGdgdmx%ٌW|>po,Vhĵ6ԟHw:۪lMխNgMkJwL)^$[{>s\Bed,,ΤN&_(6VT|bHם4I.II]XXY((c6NH ZcoWK_UZ$碖Y hLNm{::ʢݧj9i?k/h❁׍%<`kq#H=fW3.R/2X;و9^xGwdPG}ii82(!sߝYƜv0Eu`+"-uc!^Ȓ\]Nχ% Eֈ)gS?f̺}郅t!fuzw73-GnGpϗS$\L59yݨnőƣ&l'{r =PP9N'S-sIxǰt&֦jAEVt⊒;R1rg%F}>˃aahz@$N ih]IҲtZi&^r˦MQ*~(J1AɘO7)K1"csŨѹAf #ǎ;җJ y~fP\&㞽חal2G\ a .y(X/p(N4`*́p/\q ? (jK F@p7.GS":ʫz0IL* z[Lۡ EmûX /6]n88nⷿaXj.`?< /!.B B3<*<{x6|F?5IZeP `9K+v!̧5L=8ɋ>΄>g#`+ıc.bkE/ _7%8Wƒ o碖8|8LӠ;` D_ L[VƩxp,Cx6Û-H=΂ap*\n0 nå xs <#X[`eEUk 7F$S4Nxk.N7a2a '9 HECK8rg>DRJBpa3— NL,cKNvHXAXC&\Dpe7ZK%-w&[2l!#%&݄Ʉf!̝Z6=p,u%S\.%"|@f,-qOx-x‰S+g\T .!l&\IpFMꭄm c%vv hh<={%L' D80t2pQcqń7VV 6.%lVTZYIOW#@8V 7LHLpV7xw!OxO-+GLF؛}g"!#C8ds|儕Մa%̈́n@"Cao \^} 3f"K8qpaa a{ >Bp :gOG[ w!Oq Ao *$ '@8PX},wIyW '.%~w|W:Ƶa=;|z Yp0pU3%ٸvs'?hkZ\8$^puJ5v_)U4U.+[q{\܆k٤G3￑[#J|«ǐ'EF*>ʬ#abG/q5=WgQ+d*.;՜Z6X]h<~m^srpf;G9;Kz2jK6>.ׇ#{^5#N'3ȓ)Tx<uݞ=_{5owwwwwS__H_o/OW_ޓaՍw-[Nݖv@@WOꝔ4: ,&iaRSҚMI;'NJɽ3sG'$%$/LnJ^)yG]y3tݽ{Y 7u_}Sw?ܽ+NHIRRR0)eMʦ)Stީ9S RRkR6Iݔ#uԮG=rzƵG>IƟ6nlN\X$𓪭9O{Y?ll|sz_/%6OgkV>k8F-}qfM{A1h=p߼;$(6tIP%Tp̦%6^gAJnfMDJ}l|)qMҮv}2pm6S:KVZ;açX[ (iK^҆#mΒvK]-KvJiGV{x#'i K+.vuҬ6>8?mMc㣭7=m%+~$pl.0q}U5q ̃p?4JXax8lk(m|ZiHJa Ml!m-v󤕣8~rXUaUډ^t1KyCZ97os97 ʹYOZ I+}@@ZP#dˤs`{z_i …Ľ W`dC.BY{$kZ(k/kNP Hچ"38v )Vs"cuE&ni?Q[t(H&\!38Pl{NY{1)s|rOUmFm|I8w!o:[z*W[G܏T9GJ刔cie|)QL/m ik)H/eUOjz:fQiL;C_[˝yZ%`|T-~[ܺߴR7g VFJ;%Vv+TK=wR(&mruSwy52ޣFiYs>s p`sW<q筷Ʀ(W7\x=e~Ŕ;WiLȊt9W@5ȷRY μSΔ;mNƛm|z_jpH-6Z#=Nc.?V1<ҦH+J+WmdǑPh9 SӼ/սr^{Դb:X,_,d$gRSUYӓ0Hׁ\!5ɹ$#MMrp-,hYhy/{5mȿ|[ŋZiq{ϰLnpsY}q8x'FYYʟʰʰ#zogҭ?Sig*}gYҳl| g]^l|<hsmʟ/>a07VQwc؏bD>F+Ti ·W[yd0+ߢ:+o6^aq6_s[6[xx7Zmʷk w{Zpnʄwao_`퇬񣭯5-Ö>Ƴl|7~xs!cJr(gQU#H%7V[S\u(P(G@UQƇK%n]D}jwnE+̠`&Leml[ T_o Ոw`SئmѦ"l+Td{[^mW6l+mM7mQ+єєr%'7mhNJE))ED<TE T5UeP$ SO?%>_EM`(J:))A ܬ [ SY,%Р|| oo^F15>թ:~է`&POROzz,S3|xHPg&u:",ulVoSk0ԩuUC^UFhU5ulc~5G 60 6BQC!irEs9IIʹɎ TTf>,y,bl _sy#od~v_—|)_2śx7f6?a|+Jv_W]W,5l(?͆gR /e|f-W5_篳+vo7ٕOO,bWl îXggv Ϯدs6w~az-w/ȥ()a;P9Ϝg.j_/j>GG pGJHA/>ޏTޟx=B{=p> Y>~\0? A"0rr.? Cc1%I$??¥|-_ 3 a7HoeE 1vn+1vB>߆*F1 |F۱|'Fk.ew8{q? ɿ ~˿@ X{-ˈx{2 yyPr ;ǝq?30ooדfGU:1qKbõqҍRxg`#l7` =(NŧWӧdgV';S m^Րgd+9dg귣Vs瑭 ;S- [Iv^ORLn31_ 3Ed+{ԫAZzR_8g(r|~TfTfTR̃ReR"KE"˥"HE yT*R*TdTqȓRR?JEHE4bM R䉟Rg"JEIE"H=4S>]*rP*TTsRȗR#R"HEC*)T"G"tɹrTFsG12&9L|M|'f nV88C٥>F+Y ndc 6nca6-`wzv?d dCsv}:ؗ};r);XA ]*Fclhl N6M7`JV+*V^Vͪjg;ބy K G jh}S~iZt3l7&;i}LrDw@|6J1d̝79-UBK~Nzax*nZ]shNͥ5]h^ͧ5uKþFgT"-|Pm(pL il%[VV*kemu؛S\|Zebǰ-O'Q5 (*ׂ}>(zS7Ke"l3Z7TJK_Vaj,)[&.!Jπz~fJs'8919Gn: pGz @^h~X Ka<M04r(`v+FcOS;Ɵ| ܝgf{e ,ѕ$9 .9) HAH D$dQ5 ("bB2ߩ7XՇH}>ZIc 1^0Ìc1xm1^6uci0fc1Ϙo,0ocXn4Vow5ƻZcn0vc~S3oƗWq8c337~4~2~1~5~3WkuqӸm1Majyd1'pb8'lUGN 6;ǸQrfs"Mxs V݋v++ƟO;y/>|kOY'OgC@1H6V(^fWx6Q.&X?SLLfs4Ws"-QKaZIY+ba |ߧ?$__yT`<9J`)vgB^*O$$U}IS݋*꾅pBo w6uM1^N*O%W4ddǧf/Oߟ?AA!aQ?______k~~ ~ÿi~y}ϧ~J]Ӯk7-v"QV[4Y*~5H%Ѧur>*”L ~p:HZƋiY d i kGwX7\w 7diE}T0[wC=57yY^%s;zm{_=yOV@VCg_aEk|KDVq&+AxKV|bީ_ 0Ov^Oi&hXKԢcрF"F-EKOW4rʂ8}"3EbfK_D~%'S4~ +2P% 1S$}~&-~=DK#]~=L +O>9Vtw"Y%?P*6y8qT*GhB>9#Ge0|iח% _:BlW)Gk,y̯ӿc)_*ii4 9-Ov-Q\%t5$t +69YaNSnZL8xLz?(ʢ2*؏r \$%rIo[t Ժ2 OO0yX&QOgdֳF}K#GVEIʺXe֋F `%`h M%BoDݿG -}h[lC NGOl'Y[lOc$v74IagitbK4ʈ&O4!yJ}S$fXSukf 1kt}Mݫ#RI\LW#9-K jY/3oRkfKRYTΒѬtdzAq! z= @I P=d@CaC =@CQ衜CvVD=m?[\6]e~o:H#Q|,YE|_7|7Fes<I)l$"J7PPY@AOmyxEy%xe#;*;󪈻PSqW^dQUܛ?8ӟSž$T4Tw ![a[9 Zo#mA\5yz r_q 3ګCI R)Pؑq! 4 )|P>kSؓ rU>>}y FfG)S82ARf@nb(Ԫ)> iAy w LPhʊf?ٟFfl[6ǾdGiG-I2jjKxLoL2$bV&rm J*ۈ;Ո;wwkw""~2x)yUL`>[ ̏vAwTL9.*[:[:{ 555TGEGQ(($x.xnxx2J3_5 s׉_ɣ" ،OD[ˉ6έRṲt/ih+JHC_RH@(^-xKoVd}21LSLm&|3|+|;|,}>G kw;]n}7{X/2ԯM~[c30&)Tcc`l436-Vq8n45NgqɸllJ3h&i2fY,a%RfiY,g>d fEY|ĬbV5fMY;lCp;a7|5|-|='Vk1{~94$C$ݟ:S %.r70avj66h4n#T ogXQhf,仯c5>}= 1&Maav7n8lwKVmOYNCaGd_|nbF54J3h %4)rcY_ 05[oߊv(Z CKPgi>#O>]g̉LB}B}zĮ>LXU}픡rSvŎ59MQIӡ9 Вh-lvڥOZqV9sc~xv0ai{r-T.dH9F{$XLP45Sb2 UVcVQ(IR-CUGGXUjHil5fj\՚EV{T'>I*HG86fqj2}ڔ^"ھ$aOЊ$Ir(jXHeYM=A1`LzI_ϯ)IzLwq&$/#㾭Cc<-O+tD& !{ (%}&A/LPGP*Fq$N5IJc1NL\O"y1X;g ꩨ8i) ux8y&RE9aFzpEn/htLD}ޫ?~_B-''?H>lN{ư1|-WPq'Y \=q>t>3.4]xOY2BBWxeFU(jSOZX-Xq+jJYXLcff tdNVW/OY=XiLYY`=,k5zPk8KFZX.k5XcY5ޚ2tHo]QQ\~+2p0Εrq(ΕsƹXYg\3.get Z΁0[!tC&fkGLO%o&Hd\5^콦أdղ@ӕ1I@Euoil?H>WRu#ٟ f##r:M2'`'Opdg+]eK'd0T^|joD^f+_w{?4T‚V! Y),l&OS(L۲c')а\VI|.E>U"*ceQ +]L>fe=lU UѪDa%,UE֮Ba*UI[ UkV 5 (efզV|7EU"ͪO5)dCPCA=&;jMd!ى6>$ԇq qO$/=ܨmx V;P93؋Z 1/;Q~EX ҵ+qR\\-Uu^Цim_I_oo_i&@@@3́RdJ"]"6e vB: 'LIX7ۄz^Jowt}O?KF9e̤Qgggc57_BPP>WC C[CC?ȳP]ʞJIr%-SP=R HA)R) RC)!EA)R )RCJ)! R$HI)R ) RCʀ)!eAʂr @yC d3fdl Cl!Al ;@v(o[MZ j xv`e0cS361cS36U0cS3650cS360c36bƦ1XS쐚B,KaXV6Iև f6#?{{{{(== `/jg7,끍Y/v e,̮uj!L5̂dvd$s$ JqRT{g-[wHcevNޚwƥiNcC6fgvziVKR*;m`c a`7zP{hoAjo}fZi<Ϟ'a"huZ]%,ɱQkgI@5S9YYk!j1kQlQQ^G:䧋ҰHdC[r_ᷙOGօTgGژ?4:~#OUή Pƚxz?=ލlx Sj#Z='zd=ATG|zk`ǹVZ>.5jЙVk0`l\PϬ=kCee"\pAPi(g?<&ayU_EA/nN%փXRcݐVVZ`t藵f/q1"KvOG4ۅ'ozZzȟb'q-s<'uu'g7YT|UC<6*NNꍂ#zaq\,J_Eda^(NkPx8i~HG\BRe}%NU7a8y"W5zoLZ'>zTڔD » Ŀ+tзԣzo뷆S PI)"搽MP֩,^,im$KRw^ t= k)PZK3@eܝۧp nQh~Ls%gl(:~VQҫI51LHfwm`ć6uVNr i1qwP]+U4| 摎&i/Qh(>Lv&#An&fIJS׉Rl:/,Uv 8zFi E|m>m^P{4[Ǹ{o "| aFX !_H%N} KjcVveiTnIZB1N v H}'q֐tQ2)YXTV簑\1v "۝|8Q\o&ivJ5=tLcvn t4z@k@jB=|z/-5b/"pv8FZ<+9[Ju4r[@""Cgx\z3I84y>'XmjY%Nc"rMtM쏜]_tĕǕ$g(HH?&}消iRYY)e!Wc)Y:,Y:#*T3b$*"-K2{FW""G6GDFEGvDvFvEvG>|(qȾzWay6?2 20\dPK1)D^c5l%=-VuJw%cNwR}m}~v{=~do߳7ۛ-V{awٻ=^#c{9>Gw tBNXNıqNAS)uRbNqtJ92NmSשw8 FΣNc1Iw9͝ yg3y s;#(g33yt;K2g|u>r>vs.8;KΏe'gWsnrkuܺn=m6ruMܦnmpw3>n_t_tG/cw].q F=wv{=vGcq{=vϸgyyGE>------M>-Ouj?CZyZW8߉:NYt:tEg,kpfrg {v~q~gϻ͆-ݖl&ϹY:.wWfZ6e[sg;ŢTEt ZSq6^`/ً߲%R{^aWo۫w5Z{`dlbjf_ }˾mqrqz;}N?Y3egsy;}dh_v:9.NWI)/ w;˝.wW/+UjEwnqOg{=2"^Q/˻r\W+Jy2^YWޫy]>^_ yx DA!aQ1qyo-zǼ/ w;-IZҖ!'2^&DYUVF}0 a?!2#u_ LJdqrVf97p>NI&lxN(|e]YvDKc'o~EUM=Ͽe#dG#dON|=꬜ rvEΓ 9.yҴKysY&MH>sWg3i(kL+Z eRŤGʫAʅo㈠OqZa~֝XtXta[*ub]˖ ζ6Md lͼzB9r!- FC/%h|aƺf/9DZm#Fu oX F2bnbGk@R###H@J""ȉ̍#W=Iƌat̂Zx'ǡcSiDN FՂQ-̷0>.|hhcG6>az및2"HQ2yQɚPѫȚ`*c`b|-+-8%? )= Ju:9SW9SN-q:iH%W-sӊ86TiϾDUrj'װB:Mn۲η@R؆&y(gR&͈;KP֎A0նuN T-,KXRZYNEL}ζuεru]*+Vi]UW隺UAunhUMtS\7+t7NELMv¦&J25QRMMk"ej"mjtSe(DLMTDLMTDLMTc]cmIYAg{Mo3XADmpBY#U\zXƏcN)~\ˣ_)AN %85vmt=n[t3[`]_c]oxeJY:tN.,.ǜKxS:%)єRpl%t.K)͔μXIDk̈͡3oL&Rc<(-lQFwKح&%2jOIR2({;*d2vF 4caĝɆ6ysI1.O٤ ٙ%0-X,b4o%0K晔%1ҋ :g<nk<=P'S(mV+3~0EU GS-p8[QOhj& ZMR]Nm՝NjR_=@]C!QQw5UMksl % &lZ%7έv ۈ?ns%n[Y#2Y˼{o1xڱ{{5∖ce9;WeE,Hlj[4 , FYĭΛL>ݙ|a^?,q63ma9gsy&tU1:Byelb4~䓛&.ȵU&e*vbY7|V))߰'] qG9[V3Zb#D$lfw ХGO8p^ }0bX˞`ym~f9(VJ }Nu^̾774nr{i|ӭIϢuxdselo8\k~IjX`VG̊zE],Ƥʃz^^\V}vI}>AZᦲm6X_2bmAnuMn=>fr܎rr˳|9*ܖ5J(I,;\ 3f q0b#ܺS3*Q3*+PbFeFŬk3*+xW4x\C>M5'#E-S!?PO>KC\jdR~*=_R(?ku:dg7NY' SC)?"[? ^tnNAtĻR8@"I&$#{P(<,r=QvdtUvmrctc'FNBFnARI/eeߖV(5IvbٟOg7s_QofhF|Am4̨a9HD9TdI)D1me}>GrnJ{Jq*̾ǾE"IUH +ҕRJQ}2TBUPyTJURըXQ[ ]j:uQGqrN̛X{:=0x֟yx{BJbOcI*YJ?srFʤBNvVA``FՃ%71oMxnpGXgJ*L.p5-EQ@N) ȩ\vuYȗ|ej3v=Y;2ѳY<XMܠ-(fhAcdbܪd<2xr̺ގ n1ON?њ_UzbW'ӥ5f)XCm4v_'9U`f]@NךY}@Ӎydc56hjNy} J J{颥=ĩsy?wv2;7? r,qG M2&;᠌b(8(y^Qd~.A}Qƫt_ϡyfYv^q!U;sy;];Wy:Ox:MwG% hMX2[lW'K=Aoj1.EUbOMw{IZDWZW0|VʉuX_wP gB7'Ǜr|GbZ )?ǤlFј-H9)cR!嗘Or"&e;RNƤ@阔LJzJLI)VLʗH Ť|pL7HIمx&%=\4,cqۂ v*ZN`ǔR¹c껠-) f-܍MS5NS)3wlJ BJԋbJ9RR JFY M$gEz邷jfuhe~Ϳo.H#⽦ۍD| ˆVE+;!1毿5ށ8,&VؕI &ڄT9%w-wٓ_㻅/5ݮz{#; X#;ݧٝ)obFVmFcgw{1gb.~sV/:ibBV?{Uά.i-3M)&N%9#^&[l7lS | â٣\4>khl [pV?០  jka#:*|}|D7qђB\ h Ek".ZqѺCT#՘)5WTj:NRuU] K+Uo՛R}j!wA+")HuDtbC;HNoBtb7#v:Se)61T"^8^("/rEIĈ!F\1*WEDb#L-Ĉk#F\l~6D?Mϖgk ~vf<(Mx^ry_?iMJ{.,! 8c@Df[oXv;?ee4V[cqra<#[EGͬ;ݝ ..Y o]IF:^^^ ^+*`AVVjJաlgT:Q::::q9tJA[A;AA'AwAouЉ!ЉaЉЉЉQЉccY'[H5&j4MJ].]ݫ;a aRSY z:0tQ4,lӐyeͮ6aǾXt:ccpz<#$+rZd*NJBX$-i9X7,1Ɍ9} $x_/ ŕ.>8k" l^VjG3Jp\k_S/ x!E!9\HrIHr)HrHr9Hr%Hr HrMHrmHr]Hr#p9ܼܼ  | $$:Hr?H} $y$y0$y=?<|$y$fHxHm!@'C$?1{ c8l*l:lFk v~=2屗DeMʘ1cƨ&fژ1ׅo{ }Sfa[`5KKwǨoF>^_@+]ЮBhu*Z-huvjhu:ZVgE,x CiXqXa`xx"q_6> Ѵ}fU ?"է5xfuR{s.(@_Cw$;Z:+Ʀ2Mο[[p\ߊ~tzK&Sr-y6X"Xq߃msaދG CWN^F8 M4;3X$h5Ԋgыr5mFց77w;6LO\V|qN {( }ލg<>ft:UZR>ڎVދŗ].hqtl }p_-F|bEj.ZV7Zx zU8Nw=g_EfEvqpڃҥٱJ3R7r+o6umww%t"E6︚>:b|1b+;.f ]1<&|D QJDQQTD QKDH4DKK q.F1&'qMGLţbx\LSb-3bX$KrX%^kUxG''b*>>q@GY,Fea0Yq8{v;vF6 J3 Js\JKۥ)92ԒR}}P_ QQMXrD&W\DqQ()JEiEYQ(/Sy!*J)TDTթ)jR-jeK٢O9hHhLDSє=EO*)TJ(R1T bF1ʋb4UcX8(&TILSIUn*R5qTC<$1O'&Q=xb5,j(9Hs/Sxb!5b\,KX&Q BbXIWb5])ֈ5tX'Q+^k5j-oPxڊ[N-ަ].u(6I|(>c1u&*-Mlۨ!v5bM=^zb?AVPFak@ğJlh+dXVŭ2_{?I!sZɫ> M9s>ڜ$;\H|BGG/g~;ǐ#.t:(vΑ~Α{/^@ u ŐYsX =G+h 7]aև]~cU5C.)KYgVv^\{f}e BIp岝V<|} hhu5AkZ5(etWc֮W߽ce\Ͼ<gM&[ZSl9?kau¶D[D>hUX%-@ga}A}{fawP\(9R"PP^ZNQyU}kW_hHhDhlh|=CfV^z;1)=eОС8+iI0>- Z 4hв@˃VZ 2hЪ@ Z 6hк@6m1hЦ@/m%W^ 5h{@^'赠At C@:tHAǀ t@o:V@o.лA/> C>(_AN:IЧ@g:tӠ@>,Ѕ@><Х@}t%*ՠ/] :ЗA_]6ȑϑc_"'"'#"#F|!cdwȞȾAڡa";"G|*uȮȆ"F>|$) mKdkd[id%kx>oKQJ3i-e^7mHh;}Iўvg;@?t'藠_~ . nCЏ@?tK޻t+趋)áph7O{@z !ÆFF:t XЛ@ǁ f[.y=NȽ+AW]C%5v(bv Ez3\GOo :g>N<Ñg8 F39guy]wV- Y\) @'"AP_{9zPtߵLȿH\&@:tXDu?장]iN:SEZUVu]QWҕYf,w9evW+UZmt[NtGIw]tW]ےG. ktU.Qg̮PzoDQ4EL?۟?ggB]- 3+]| dN}4r90F *)y?k>.~]In[VM~*! S~)ȧ\9OΗgP.syD.rB WUr|QkKr|Y"˯K*I{$<(|M50͎K"%>ء $/W8_x 㓷d{؛}qAa{=[kG'D˳V-a FSXn6%s-Әbw\sEΘobw\s]1?\s;=1{c\>s}0P#חGIJbx[<oLb =ZF| _y3Jc5*k-2F26-ykp?=G> ;_omp.8?'8 | 8 ·|$]WZRYqԏӏ_'wFc1do 0c1i^6|;bt54wݍtӸe62>FqxXb"S+b,TGL3L1K<"l1Gb/~"K'E1@ FDxT,bX"K`1D䈡bGbh1FL<)]YbX-ֈ?bX/Q?KlϊMb"[b(/EC$w+U{HxS%}bx[U]qH'8*>"(FD)8-JE8#KQ!g9q^|-ߊ ;Q)!w GQ%w!ˢZ\WO.w#wƻ!=q8j|h3f7>2'Fq8e|n6J2 z,7g徑/ 5~{/? '=*{ɵx{z6ljAxfJeS[~ѭ5jwZ㬄Uq;ky7Σc U3_71_BulUVs_yKv]@-u?^ ˯xEz&J?:UoORXͣS>Dt 5DʷP U )dUdUd*a20JL%L%X<>'6+Hdk>gJ:ί+S/դiĭFjqiĭ9AJn!Ot+(LUf?KGLKtfJ?N:cuԖ$9VFjq1 H;VS U\-T6]e:WYq%7/&beAq<(f9{y3,Uv۩o~RRm9V9t7ԗW%LD7}.EiިRtyD]GtљDWRW+UѕJUt*R]ʼRoo\ ѧEoY^G?OG##7NH?֚GoM/hѻ[RA]E(>vGiQ}24uӐM̹jQO2b4D%RͤT7( 7TAoPOt?ѽ?^n%Й78yQ!A,'~v(`$\,w3\9g+gWGn!:3~-x:y6}8R|*Iq5ZŷArkg3'+VWnZ]rkʖ3^se%*-:,G,o'g!3>髫5iyt|Hm̆1IX6ӵy*C|8}3DwBzxVxN!jCD]By1In($7;vovHRjm:IYd*Ug?Qି#yDOt"g} +$&T%|V{J[SZSyz)^wz^mmk_@x|k|/Xͯ:{JzoQDcZWM~3Ia.ԂC^R+,B<1OttA\z<!%j:^hFr Iwx":.x"x.OeCX'z`#QFx@9zqh?M$tN<źLOgXoP`ɑ{^kWu cM0r#1:]sn-yÃ9"?)12114LFK)dgxR/bǗ/"&#xMFhSBimW;}ݰ m +ܑHw pvp,vulsqr\w9'9 ˝{G84h٠c ,msń 6O3x_ ;r_!~2~WKf4%k)ZYK uUz.V]j*>CqO+1V{l⪇c<.LƊť+Y*;N]''uu4RiHFjm4ABHi@7?6V3QcuiT)}5n&jm^^ Yญ?`OX@xwy驁r#1^xe=/XZ7OMk$eUns/QibW3('QwxŁԵ:[Fv&w(JM: =si%aId Yɰɳ,@UF||}x,-V iJnpv%?lMQҎGzuANg՛,yFO3GMF]R۷GKFX/aAM_ ˘#ԯ dVwm#ٯLJ(2&0nOqpLw+$Ľcb_.",rteIպ0v|R{Pv!CN(gP?1Xx +SI_5USk8*d}jO}joIQQڕ$@UɊU@U+ Tkjux{ߍ:ԶWʅyE.{-rE>Or j!JM3De7ՓF!jV4J|cir>aה)S.z`jʩNK6vis-~i{v"ojޚyUt^s錴364s̷g^<+eVY;g$kq=Go9f}j9asĜs=hΩ->wsVt+S^n:c揟_4rA ^.ju> m g r)r33ό ';<~!p(<|3١f09F6b>"fMc!bk9iF˼{"6ܜ;VN*1bkMɣr.yJZ ?|+rҊQ)ܴ,V!ܴ[e;N5/fy*#P3?d?s"f@kkgǚ(9nqRvaEaJ.\")N`,Qgպs6hf)uU +q$ۓ.qa7q,^rXJi(]@ރ%#2< /TO+%˸y.d5.`kc5}rO:dFlM#Q)I7eKxOSo}7;z_ƽXJOaa$Oʖ"cI^X45 %%3a  Kŭ usHK_j-kKPk&eՁV2X[(~n/H7{%r~]0Y]"v Hr=\PXEGJUr !`Ạr1hu4VVr uEZau.huRX_a߲~rCRZ"*@+6BZ:[$e.)Ѻ+_,:LH[&%u+6X̷bNJ9ZzO֝u0[K0jlִQ*[^i Eĺ=|jJ,o0[G۬=p9U2ziY:;Gh>e\X͢DiHym﯌iÐ6 iÐICgq8q'(+A}ΰB}l<oGWlgY95keB(loYe!`@GւuF>fctl ,`s`0Xǀ%R `$xug{|gX'~ ~0k;~6u eIlmkl{;-s P>>NR ;k8w";T?A,#Ep;I'Sgh`M0&x ~u ~x:dMBZ!#\` GQ*`5xuy EG  CG1LX'[+ rzط+L5m[mm˅uCmЗT 9Р;7P۾"Wгsf; %=;TeXf֌ᬵ_P,Ge\( b(JD))(5JiRZ[P3(9JRڢt 󠌿A^ A|!e(}> )G/ }48{Kw!W BG1/`n\6;:,W?CʀZ~k8Vthf)4Y ,fB3KRhf)4]]]]]]UBc1ИjhL5w+=l#\h(WКRhM)ZS )֔BkJ5КRhM)ZSFOV'ыR\5zVުFOUJ+RUUUUUj%Z-ZFVKъhRb)ZFi #9/ۊak?;w%o$8B ;;;;;;;;;;+LLƘ---c2e1f/Þ0fa̞Ø=1{cna~q_rY3(`[ ;v h,lglglglglglglglglglglglg9s0K0.c̕`̕`̝KK}K}K]KX9ۖۖr-_/@K_B__s%s    R}Uh*VC|%^?rh{ J|7l'Y.^)RFS+|!" G! }y3`5GʓHY:48)wBIO(;J:Pixh5s &4 ,X8磜hm}; D,w VIo03|\ywC`M(m:ObarCYopZ}fY,jŢfY,jŢfY,jn䜂nB9Ñ39Ñ39Ñ39Ñ39Ñ39!m 9oaaaaari%b-w Z-d̉k7'nNݜbG G#OZi> h R[T5 h w@w@Gtw݁t2>@&p/< <l6-sVy`'x^v^^^^^j; .px8N#QC<p+< J0>p8 |;i?|;r: ^_EJ x|p5/ O!^i4@D H|'CnN !Ѕ{H[ȷ\'پB5_E A@0 4€p hDP CqߡPw(;qh$@Sw>vwN8 p:8 g|8>|ÿ/B|_E2.|_ ;F]_oTܗq9Ygl܊9᧸wgp104>܏ x4#x X෰3xX0kGƟ,uXXZ?OKҗ[ƚ[ƚ &^W`x&^W`x&^W`xݣ,G,E5es)x/eQW5V}@T2z|T: LDC»CO=!]8=: &`d=={b.s M%aG{O^Kx@~J}'DπU_S7JǢ8 0(B1ƠH a,1>*)>0p8Y,bqx18á#>qv ŧyI|g|ǹ}nW|ae%#ΫSn0K q+8N#SaQw yDaǘQJ!=cJQbd[L8K;}߾jm٣?-#[؅?NKmy'hc!;Ӹ04ľ.v嗆v[.\֖|wTp'~p7{y~<#GK<DZxOx C*񑐊".wO|{ğ&vnH?a[]l~̵%%nV27[Fne䖑[Fne䖑[Fne䖑[Fne䖑[Fne䖑[Fne䖑[Fne䖑[Ka[E2.|_%a3<<'4s؈a/GʽJUoű+0 w4X{ܫ^%* [0sӰX\+ĵB\+ĵB\+ĵB\+ĵ"[*7UР8D"_ե3Z]ʸs{kPu Et-k]ZD™ Tp3Lg*8S Tp3Lg*8S Tp3Lg*8S Tp3LZ(B P-h@ g*Q XCr~]}HSd?ew> p&P}WkxWkxS1S1S1(F95ʩQNrjS(F95ʩQNrjS(F95ʩQNrjS(F95ʩQNrjLjLjLjLjGEjaP 'e[dQ? Q|[':y$|S':ɧ.*MaON6uqO=ݫñB6D':#YE܂Bc8vObGeaoѰC8G(LѸ9W*|Gj\i~k#\qF܄q f# #6+teG+N/F:~={fYނ[C}l'-:(v{X{C{>܏0?(Kc8 0(B1ƠH a,1a&`CqXa/ {iK^Ұp>>O .g9 >.qu Ou>ݧTwiӧT_S}}OJR޿o^qiot)mki[˿6gʉoSGC'];INvҵtk-]kZKZҵtk-]kZKZҵtk-]kZKZҵtUS=jGM5գzT{';INwҽt{';INwҽt{';INwҽt,97&܌[0#thg_'cˢ W8_S9U*>#?aI̐|/{7]axM6V75W; cntF&tEcb:5cpG=^b?-쎟3pV !2%asG03g9Ά=tV=Еykf_q߱0I<awXj_tSk Xf[-hw^OhOPh/z;,swXvק2{2q £x:F_ڧj+rTmjU{.UwPTMf6S3KjPr*fb=l`3)Jf Pl'[)C Pl`{(LP/C z(XbJe(T(5@J PjR(ռOVJP*C 2=fƖ?PF o35|OMu'TeA;=SxX/ 'T{c||?2*~\A?%|jOj:-aj",^2^JUmW|[]1 ݾ7nyzثHtEGz\;Ė[o8g>jXS>qOlsuW=Gӓ=?5lvQ>v|rzUZ^6E6:6cء2vm*cئ*vݪbȩȩm*!r*avpn7+O<"_zϺ"Vang2qs?z=QO :؞{;g͒ery={usk5{}osts=1R-\}OSbþj7VXZ`|2>q0 Ǐqag>G.&^u;:(Laj͢ f%Dr>Ma6o{q/_Fe($ϏTjn;9\p^XG*r@5n{{{\?G2K>ToFQr'>yɵO}Ko-fK7[:(>߬7+G\0Wp~[VVZ*%Lm b3ml wwpL]\RKyi؋]X=Pa6՛-&w̌Zw^Xc B UF{\hN9Ra<?8 U녪BkCMüw8x41q?{a893?ME\˵\/6/s'yħ·tŅx|ANg\/f鐛߈-Pk^]WܯCd*g?ф=9!=G*L^kֹ׽24MVfVk5GVeVeBaNu|YR-vf;"efo47'+E,Xd,^Q~-zOI{eXf[f[o[7{fl|Fg3+m>S܅Cd7zzɄoқX͖g"uH/R֓֓ۚQvӕr\.n]mWkVVWvuZQM-SSX[9Bѭ>A.W5xmU3wXgM-TjxJ&ʮjSmco07GȐ)jʶM$i֙u&ki4M7-&Dll0L;LSk0ZLVSk1L:dm26VSj:NuSTg:m2ZM}S4j5ZL Yml1Ypi5V.[M&Vbidb2l1pS7[8UϩzSu~o :A7_t{noN-\[t]EoqOewWލeu|5_G9f_jV_;yXGtAsx1G1GT|U>_US9U>_W{赘NUZ-U:Tzu=O5}ӡ=4Q5}ޜꝯrȹZ{T {[*ݞ%e-nɪHɬNfu-:ՉnD[DE-nufhv[4ݢE^;:ҕ2ɕt.Q]m]2VjqzZ bU3p+']9IZ z3t׻z0ay;%\ye/&n[}P}#ʵ{gwG8zߧ {Ջ;.p^sso4Q|bN1 .wkvc8vakvkN;]ot];c}˲W`n"WʎLՒ>/7ɾ"=>2^/ˮr'$<1ƌ.}+}/FOVg:MJK>0A+C :CZ W|]m1ݚ( 8YG:EGpN~9nV9nj=X=XV?M.q1wyor8ꛩy׈)'.oqP{37G=TLTLTLJ=LLݬ2OLx%YDqU{M=LJ9dR0eg⥬t)+ݐn~=gK٣+zsV!ېmȾ;gߝ Yن;zl){^+͐f2^kv~_ri>=2UXMCZJϊƚ0y\%*=;|O7\>'F~AHϧxtVy=3|n{tge?(̿ae>8ucc3@v2٠\m}3mo];*If\! Ɨ◤mʹz-#ܩӶՓmz4JxGvKvKvKbz^LS+cmǔuN;z9.s#ǹud~m-nnnnffL]L趣趣趛莊DGW9Wj{\m6uq7937Yvv 0tpﻴk՞*y iw\@vSRjw۾ߤ)NvjShF;5)Nv*S Thr|[oq7q7qj6g]eʮ2%,A.N2% 6a6+c߉GWG+qOF3}L0a~I 8gO7^½NNI>q NpN8gl8||§\s|\/K_Ř"8jExeԫQuXZ5ڰp_x u[k½揶m=.{DCvN}'l\-,t/ Bwx|9V3~sqa]t L LD|'D"|c | u\WU膰 qnƌPTsjRU? ݸ<܋p?x {O*?>9o ^DZiku(`pSOWST5>UOUS[|Ì0MOS4u>-F᧸wg?]/FGD/# hG8ZѪ('=aWgquWgqu֨_Qq OI<_i,o[Ux9KKQ?ǢӢ 3? panlj&v5 س]fwo!^7Dzݕ7E%Pa/Nؙr+!:`:nM`fǘٸOi4bZhllD#ЌlB+6c =U,>ˬ9Шg1FJ̗Leqq80$pF4LVxׄLc1n~L7?S R GCc/G}cчpQ8 SBNfYE?]9ןp|*:B7*zvov9yPT霪hLQ/v9O*a&`CqXZ,bO88|w]+1ٸ54K;qg&EqꮞZ'_}uuuQ-{@`A z:}}}}}Q}(Q}(Q}(Q}(Q}(> Op$> Op$> Op$> Op$> Op$> Op$> Op$> Op$> Op$> Opq1ځ? i %D 2QL %D 2QL %D 2QL %D 2QL %D 2QL %D 2QL %/k| V%yd1,-G9I&! Y']lnjf]Lfv'2۝hr\?E=N ˥rRnDߟt2];&Ӕ% Y#yd9,<ӇgL3}x><ӷbG1pr 3%3%3$3'I_D%I_B%P iTB ٩}B "$`SydtՐdڷ0 "H(R(#{("eץn=Єf\7ZTF f3s:R0<Hl?lꬋ->UoS/s`^h-h| q>W?>VA'|􄏞>,h(,ȅBW00!m-|>‡!!!!W;{ Xkkkk[ [[[ [rI~D'I~D'I~D'I~D'I~֕u%`] XW֕u%`] XW֕u%`] XW֕u%`] XW֕u%7"i ww{_( iZ%h3^NFȁ%-ZM/V{.po7 ̮ۙ{u; 29σy0><`|σy0><`|σy0><`|σy0>GUF&7n+b`7rAA.rZП %N֓eTudWbBf׊~iŷ^@g~K[w1 jU^dKe\LPM(?+ =br.d>%b‘6Z]ӋeVfb>UԞNrm&C}5ymZCv<kG둽6[{^f_!W+mzU&a"l18RQԛzx< cX(ƃp^#57X l1APT٠:5@MP  @C4M@S 4-u:h 7` !0xc$ɘ $M9zy>{:e)=O?+$X,#숣Zc#xf,Ӷ,:Wf(׺YRZYNl\m[L\+Ny`0C00#(07[0/+U0 Bx,o{:Z `x,Gc u փ `#HM 6- _/ŶK& p.l_1oO3f\Ι|lc3u7".XL,ncwK FNqA 8#:_eJ2jM ꀺ|Y]j& z^Ιzkplr~t~p;x?3|P7EΏVA]S7 A]~w.}L$0<t0<33Y0 0Gyxs5:A\ځ0}~x<1`,xcq0L0<t0< ,{"W,$zkrxR 3p01B?)s B?g죟}~>G?g죟}~>G?g죟}~>G?g죟}~>G?g죟}~>;?hb4k1Z\\\gE῏G#DDDDCDChb(F3tJ~g1?)xv n )>ׇ_}>ׇ_}bG-v}|k>|8~g1g))y#u7 El=^!z0*qrH.CQ}W~ Z!ZU k]1\*5Y]S2j|%k9LᏲ#:NKsdoQDr! tq!$2Ҿ`px|*;wx+AxWz~|, ¡vK(Ρf5Q"rDQ%v0RLubz%"Op=3`đ _/G#hro9cEDgSTz}HY@6&Zq0V2nq16 Ue=bzeg0cXvͼ0_ʍruh1-vҢ6-vҢ6-~Gؼ; rg*.AG'wؕ`јWBqUw_ _ZC{:{#69|qCFsݡg;)QK/` O=ϳ#vu̠v^.Ħ=4%O^"jD*bO{>/ C77Ȭw p"h"5 ʰbg[e+r6V#za_a_a_DJ<1#(LjWĬ+܎a^bdO?OO[Wd2D֐k`hKy,ZEq,y[n`Uiߘ~c*X=04bvϫSQ+}j~G3zgVYevk3>%XKwf,eh]Nl8WY}]xԊC\E+öqw %k(qö-; mR+b`@<7ן(_^w9:,+[DWSVmzCpz^5^Sq9Z,+p!f< a`ڌPSހF7Sj#שULr(jW>gjՐ@cʛRe9o*9ck0CӪEu>34&kʽM {9\~k3:X=d MQ? v_7huP?m&|~ŬC?iW`FI=|τ!MO=DnDDxv,Ϥ>=j j-HfѨ.Q͔ծb4Q!Q)eEbENgENjr]KªsYJ3> א:@cP)Q9Z5Qʕ`0ݦV*-"~otWmgh3/՝/j k1,jwW&J~^nJ䳄-Ѥg?:G\+M X!׈ UqX"s!b"E!=b1ꈵF},heF[ht{FW=D+13D43x5^1^59yyfKqyk\h3.244~oɼָlm6.3ۙ0o4;yf'qjan\m4{ך̾F+s9y9Ƹ||iN4S s1\d42?57ͤY`d1syaoOڅvZNrʔ/)WUsuH]"שe25ܪکv@ݠn;ՍFKuT]n]Ū%}uWajkRԊZ֔ԨaM֊ֲfGD[s ݎ+n7awwYo}ܾ;n?;b-vì%wf}~~fr׻[,JcV&$6)06%BdBȬKjF]:xwDzwy7dWxUa07{z$o›=aM^^/xz{oٗyzK+kVGgvk oKx Kڷx)ko;j{/7Vܶ;Hr<~,^3^Ӟk?ojO77gGG?l?ܞjϏ?f/?^i6f|v%,3+^U5yVz#YtBxWN&ҟ^ nq.|)kdL:=t'ڬ䬨~NG탻i}S;(/me{d"umv6 MKzl _봊wbR視:|^kD;C4 ZXNޝ | >Kc+xVsq)g »ӫAzWzDZ WZփ8:~;{Ί:?хx'sV,@ M(o}^QQrd7o(:zo~[G-߯svWK>e}wnXF7Gگ闃?6;ѝ53ӏg~ַ~+[[Wh ?PQ)z8˽+"^^o "7`'s.ÏG(f'_:VΫ8>=eK}l[>O o:dh_&6!e䆥?ߵ)$2O%qVoOgo=)G>*"yP~]HOg/zRx+~|k"`Beן3< >vV~G _MqxP<11fkx.pX. ?U@ąb%!:݌nb bPŐ@ŋ{;>b(z<)F1,23mcm.ƙYf 6m.&cbl E<%[LZ-fEF/ŗrlo_bmĺ@ӉN_nM'vNNM'N 4Ƞ57ٰT5ÈΨh:r*jcT 4Q=tFs4A,Ԝ6:҉q.d:UjFSvw:F\QmQgc{Qga2h"cdlxlqt^e{{W7VZXh cS5-0-FA5=0Z8h P5@G偎0N:4Y1SeUϪaYGSzzLCQLO3JRbx,5Ce*7*򿋄Llz;c\#Q(j,GDqWSqLDzd#e^[T6^U|cn5jvQa5nuBk_kZԦ$_d&✇/j(~qh.o[8nt=|:_Vk0V"1:$[RQ:b YBz_Vy*O a+5\j%jZ Ga4a\Gvh[b' "nbdg:FETR]TLueU wQp좻h[N5j0 5Q!|;-NNj#HbýgPgzqǩܝ&R2IMd5:S4JX2C͠)`,5Vϩ(f5|J^S hzuXbeVsZš,UKjZs3zO*Eoעڦ XhbVrESUJq:͇!jV[J)?`Qu\\j:V:}U'"фw Dމ&Mx'N4h;DD1u 3) b0"'Dv d(ك J( dVbXT `0V3O'D0VDUbù+]QEvE])lAƾBy_q^dwQ8X($p} ^0ڲ?\].du1"]yd0TmU[J&zoP8+n9atsVMx6uUw߮n>j̝l2)@zo1!A@D ^x4HEE"]PD@W֥KwRc_j݈ #3~[o;> yzJ.yлrǢ 0-_*GWa [V- {Q>%%?9=_5?uR.y#_w3~Mr<;l1޺L (zGN  b6gIww}8'32e?O|%@Kx9΀m A*_1^?]{Q$!$@pZ[SWKSso]yęՏ, EO] ҿB}H/I!v~}]%A} ,nx]m.Xv2KK1WgI%~~ \$g@jRw1Cy߮w0_bvF}22N7EQ!VX+v+\ȡ1suSIo6د&׺TKVκW7Jn=ra➬Ԙ OLu{-:σR7弆{⪍>vIf#B7ݼCVw[3&*a)dduJc)y"qMr6oq@ݣΕDh౻M(E7;`a'tWDу^)ƭ=4oL%NGkgv:ZtƋ۴^zIVCWiz\-OJVjVUhڠ^ QKmjzj+mH  ÜeV3AasU.3󌈰% 'r)'j^i^eך]9#YߌLf}3+Loƍft<+fYF{3X[f|op{3F0ߛq;wZ?Yw1Ǜ19ތifb7c6sXo:x33Ǜپƾxݔn*nbv7dv7سy*yT TuSMUe^7U~~_fF7u3&^kόn3 MgF7Փ~?NpHvv'IP$Sw8iN;NS^s*;U̸e55N=ļkj2wMMq;-4]S1kQ]SwMu:<]S9 f_S }M-b5ع۹[-q;D2f_S˙}Mf5Y:/8[6=lwΗΏfeSM萡~aV6;?4B fPP-3-T7m 7+BBMʡPKFUjjcjjg. ]l]lg6 W W3lnfe6/Clm 7[{f$s#Wyi -f@J1O[3O[Ł,i 2O[ f@si `hO޵n#W'Ww[cI"DJ L L)5P`&5 ̡2(#$,ebEYEMry]|^WuҳunA(( )ownG9QvFCDQ!Lt&"p5 4g3yǝQt>#-h(H H H H K{:r(Q[!sCFȠ F`T,jF9p(JL a y!BɡhRCJ QPP)*>#AP&**pP9R>TBC-0c;:w wB_ WR#?h '~,$! `JP t@jn`HQ $P UUT޽ڽ*׸P{{-Utsng3UqL{#]ݮH4Hs{74}ܾHd9`/!osorHvrG#H9ǹB3ޝAQdw2H3՝6Ow܇~}g3~}etg"v;jT+rOuǨ]"w,v#iiȥ3.s!v税]BBDݗ H*p_s_CQFmh6[P&0n|}i>t?B(gNJލ{&ceZ|xZ+e~s~.Pxm#|v™a( C0, Ca(Y0?VP3f>Rg\^W=9ȫ "Ro3-п ]YXʫv j'$3e [ j/$sUfj[a7W? ,Gow먢Si GULT3Q 2-U3hܟ+Y,=l*f lA9fYfd=5'fc:< @|(l:'pxT|@S)&O_VJ @ J`#*N$dJN O3 d>` QP)P^hۂo+?E k1}kA)[ W L44! A[ . .O\X~ Dn O,Gv.yHX(  n#غ`.-غ`t3x`&=7ĜoOBψ L{&p$c<{.r`岂 "@e%_"^a@.Fy/J~yW+Xr%b%XPrV|A-% J.\P򹂒e|E oa|XqǗ22d\d\aVV[ 2L9[Lpp+e +U(ŒK.$aK1KX"vY"f;;vK,IX XLa1KX,aE,IXRcXĒE,,,bI"),b% "f XY"*,b"f XeưY"$,bE0+?% %ac,K0KÒ?0KÒ?? ؅v],a?,S,k'a X0K2?̂JMT⟴tj:5rjuRc'9F }-yN}+K4dir؇iv΃lCi8"EEйL22IJ?ܹιtA(#{8D]$:8PN?rJ8A wF4ߦ07扇Lp&@s9VB

    $s<-~>O77}y.<䉷DPN>LeHԅ-a_;pw$ORWO^x)KޏuS; IM'4OLgq@sAg+Iw!I$Qx&3qwP/'?9v,#~~ 3Vq!|5/f _` (|?? ;0.0V0MZA 7i!YMZ'IkDR#0`-aId"kp j**e8XEEzFzReĪ%·]ࡍU]wu5ᩑ#WÑf\X^ 0x1D#{>VFX =!]}^0[or.싦E6F7Ce+p(RQ9IozzwȾz^ 鏼z^ 뇽]hT/9ALrY-q)sTr)9 rV\'%.h+jaW^w)aKhvҝugzQon!"oO@CD9JcEN)"|T)rh\(r"\!r"_`I.z3wEewD>N,{>~8Od {ɚA~_9"-!QiL$ls$\ /Kf"Z?r_J,Y^ ,I%לOP[snj #ecELk5w+X"TXvM [d%)<%DB䳢Y)rh֋|AK*20fWUd⸧YzF v e2aGs^/J^G=β }aԹ"{%?,rȡX#rIȱ"r9"\(r\"_`ϕjع_.Xhg2/7@,_C0Ag#˜fN#AzkWػK @o(ypoFycww/,}8/*{q^T&{P5o7<ϼR{+([孢_aV^r$OK:l*qʹ [Iayز~?R(v<[Ev͍'()-ߡ.+-*[IЮ燔Sq06MqoE94Y?7,]8'["Xٮ4 Y%bGIޭmTUVX{s"Rj'(1_JWGdLY7Q?v񺐉z7` x7z]zvC Rhވjػ-KEn ~7m t!Xs-oڝvow;JB9;"Z݉ơ{{4> Xww?Z+uMB9ɨaAA0śةd5x3лG,oF͑QKŨ-I)#.GW`ŷgh9)ssȵ[kuhzuL:,c cX'Xڎ ӻ -Oʈ;2! xPF<3AqGFܓɈeeă8u%c,c|X;2!Th_;f|qq cvdC33/Aqʸ;2{H=((ǝ1A)‡ svDEEywBj^5hk{l/l5A..FKG.\2lȵq4Q{_gsNF)ڊl+|MKye}8m:n5+z.QJ-kq *{*SF_fq:LrTX)gAU8(#%Nvk8ױ/0ӏ#X*(g1n\8}scomtBg6.&1y91l+d鸸*վ_+z28"`_J`϶-Zs-t737.ϫl!W8-We/g ̋zqy"cb-RGW_W f;N%z+R1N)R?2+=?o13b|8N7e_wiǡfc5927^a٬aӷ$KhŠ*[7iJW;L;Vora' j} 56ʋ/C9]T9|~93SQ7qۑ#ǸV!.+٪*m Y_5kV7~U㴹S ,G\1,c#*FQqe&wbc Ϙn0_m<rw+`53SQWkVs2h4d#n|3Jjxo3?g{.>U #]>5ѹ0jx:^]33a}r*5bum杍5%dw5f+1X('B>-HUVoVa0H2ҁ.P&8*+"U+zc*XL cڄY}rvtE0: r&Fӭh|<Q!TK[z^$',%,-̐^^+|ߋս#oZaΤf˶yM.4s7Ѩ_q’K+ڴUa:7i TՕh|-#^_4G?##a"imeD<|q=k ϴU3h}޷9U]sNWeek]P625K}HY˂S55ߕMKޫFI rv kVqM*e'Te#gI A 2/)ݑr& y3Or%gAܨl˘Hۣ*X.Ca|=te\+:NGr_%&HLUe+QzyjOvZLv1+C}5"+`>@Z6J߬3_N* #U6uk$W>dTyD~TZ,Rx 6i|X;ɛY%K$ ~i/_IWfaIW@ y^Vn/f`IȓXB QV\x?/w1BACwYevI0l^vɞRPZCbOzLP8SjM:žHӥT [NPI ָ ZiUV~R?j';sԖ_97&gŅWP1r qyhJd61%,kY[, :(W =ާrB\ ;qi83_}37Nwi%5YBOǘμ!L b%[乼tj<-ůNs\ oןpfu(Np&̩PI(xߖrmǍp&lP'FV܀dVopeJ,XZ*e%gdQljހY8)1!+.ovVi[|6q+ÔaDʕb5XEz4etY,XV TgUs>"f[;@3 2Jm jZ+c8}a;iqq3emY;qETL4­N됃ƥƥ$)?p޵i 9R*QAYg#l$q\9pNǭCSr68gjrjj3iة^^آSNİGÅRLm'Ϋ6¿GG.7K,J6:[ d]Y 3\caSa5t&u+sܺ,wN|J4o[|3!ޟ DK\}) 6<(. G<^'<~CVqqpJ8'2ka2yw cz UK4څ}=h(QX9C} Kԁf} ''?_ѧEG-YO)3c| XF?bʍrA+ Qio1"F0cp 2!eǸ^6n1S)Hf̀xʌMv*25^REe6~d(߼Hyf J813ڬ?̼~y%Q(WWÿּjs' Yj8ȿZOTpyRU/z^k/WWQXc_=dZT` _* v7.0;5q=iyjp6L"o-d+"ށ(pTe 9*g88g89exlO!kX 10zƼy!4a5z.q1sT Չ7X$g,ߪފ$O$OHH|2KǹQ k̵^Z/s|!Y>叔 sgcMAiwm1~$~''brRKmNuǷK}?,ޣo\3Bϻ6*q@ Ӵq2uz5ϸS \;Aߙm=~tvKC:y3("pKlp^n\Q3E2j+1jF"|;>zu=BvxXhfB~e˒ /˗"#;x5,ݴL_j9t+??&\/_"^%q8_'/$I*4 !dCAeՌ<#ዌގL-c /^/_xY~5NQ2Qc k6fG|n+ $F=IC2R Ņ)2 L <3|3aYEf1bJĔeLaM?—O9pY@h+ns91(sBsQ̡fB8l2Qm8 ss949++5k%t9QU6 jČ5¿μoB5'ќ2WW1 k0߀7E~:;?sU1U>|i 5FjjQ{Mc~+5:W{[{΃eq²ȣzkb4}68p;]ߩI=`YCeˢ'B ;9HDonQ(]F}٦2X)q[iT 5O b~N!" 0X&gN@_M5/_0yyneE)3E#sj>] }~-sU451<3\|y ̑1c.:h? !ȼ8y&Iܛ:J𒪳`y9up81_eM ;pD6 ~ի΄Z̼]JO&4X<7.0UH/C[?`|b}O2[c}a}AֿQUo%4 d7i@>o@q@i@@.X>:І:9N99p.u!ZH`ij|VW'g%'+GHO$gAg(5)X+l9*|y I3)9X: ,lؗkE霓8}1 wh\),Td;` r֖Z{=yZGpFg?K7KMdlNmĊHműJ[+cf< bƮ+fF#,3eFuhA(sr>=;:/p1 OB *4w9qJܷ2{ͽ}Z2f&OX'JYༀp5ƦjQÚX YŖm[yB[etwq[ *nuV+̯<]7{@i}D&NԺĺH-PZƲ+12㫜Awn]eeຕ#q'4˥3*5}&|e8V}XRe.圲.krp&JϢa6iݎs™YFpY^pڎkfζ9y4?L0ݹ]vMy1SGFS qrn?}L#T?au,Slc)ʠhՉgdӱ oUo!@/[Elh/kN4]Q]dgC!g ҧS)V]+}ZPžvlu`;tgA֟c̿y6<Ϩ|H-0TnBT{=1W0+qh{UB|Yenua[ɴ(qlj`+{gL S)2etɔ3e,L)ӊ)Ӛ)ӆ)Ӗ)ӎ)Ӟ)Ӂ)ӑ)Ӊ)ә)Ӆ)ӵeN/g߫eͧ{agMÎM߫GݝXɘ0?/%9nprY] KCꎔ$K[ uf6RL-C4UCLDZmЇNssCR{A .UQ:@@ uJPWVFUWdzpvJ*n u,uhgI3E Ba6GӪJn2ѪsrXH0B88ރsLsu_s̶Y>nqvk'M; #\^ow瞣wvտ>s];]ϡ]}zq/5p?Y>`^!"Si3Pg LFx5j_jKER!oYıQ>WqV[æ3{Us> cXC ި ` eQgmCQFCChOiOўw|;4Qȋ /6HA$E+h$)Z77~-<-Q>KkctȂ^+Q%bgK#^S?ePUdV)&߲HYu:B:z@sevՇ KKo"k5JBVʬVwi)^x09RS\RGjn&qes&VVU}nR Vd+RWkw@;}I݄>ڬnEmS.~~? hUJ?BIhI=Id@.4QjEPo" 0>7U,'} 7GʼnLl_>)E]6'-)) Z[Bnm-vp;}h!N|6[hJm 0aκ"k|5y5nD_K|BFoNXv&IЉUtiFfo㛟cW H]7xx'߾"zil)+Lw*E+q!HEFJO((]R~u4BBBd]o5tQbhưwzX׻0Ϻ ȺDs9n2o3o)Э\s.M5hyy/M7 i\L /ӝ~ͯlk;#;/_L/_F#~_E_MS44゚Mhˣ NVx'KNV P@y(il*\7m)0!x++I6F:ruo#D%ś췴{okbŌQ:Z bLjrYíL{=Z 3ݕ(gj3qB'Tzz[֨ 5[r.N6rn ϪomF{p->`!/T)\Kf- i*߈2ZgR[Ԏ5'O3΍\KO[B V9p|ˠ ܏G03M?O`ÊJ%b i4! IGO` ؆%`{X:CKVH.,cU |^}GZk,zB҅|">ԛ"]gi%gKY `W7S` 6eY>ؼRWb,,,˪Y~հrj8].ooEKW+?AkkitV|>/+|gxeW V1<*1a1jj(v:ם6_*˺jE{s6GRkx<ڿR|򣄭R>c+B[[:1C["YBPȺk;ОIf%Ё'm|AgK#-<4[ǷC[l?PƷl9ǷC[|jzhŷ,梎|롘o=[ z7pJN}wtЖ>tD1~*qNW$˓7$bJ2ym߆My8zJYeѤznEeطci56ji%]\i 3ROMo<^k1q)1cY`5G[;4+7f|?JDP fM~ Ǒccc}b}hY_)`'2@ߒ1bO3O-AXs!U}4N&Agѓ19'cOXXXXy2ᴚX-Wl ˱Z/6'͈͍͊-Y"^ ׁ +3kbkkբwvߧR<+ 5G`UKd"b*}&Z}X-WԋxDp&?hhhE4MDGDNNN']$":7D7sh]tO[wE73C9i~PFKl(/ct* X*RPd[EuOQxFxVx.Y%// / /w)|5S0iDžpQX [s>ኊ9p8QAxD!c“_A]^^^:LOx}hZހpAG>=m;g2RG r~j ͡`.'z08tF;G YáB <8,YdXK.QX ww w +O@0#fpCg 1`zx \D@T6쉀bxJ$~4*PIfPOCc[CB+Vքf 5ЂmТКPq B6v>zs~Q1? ) ؀:_@/?:6cǡ5ZFQ9猞 1dH}cZ|wO'B 7PT#ۅ:{*w>`qeUUFtFiDDTUT*1D6F6ab&# MG6ŘHǘ11f" ,H9UVίNnw=w/UP#֩mӝokBY^ibͰ5a퍪Twsy.VWq$9/U u5z]u5Wα_G~{՟$j`;9^.<$9=iմv ^k~\{SpRdu?EuBQmsTMRmE6xwhkTM6mVnhҚF6m'mGݩ jcuYfoH6mvvvXհ퇺G5Qf34*[;==a'xG-1&Ƥ_Q3 E9]쇐+;@ NWN ;@v 98i A@d6 S%@A_ @ AJ@A@6I砩-Pפ1X=qcIר$A6KW^Mil}`LA=kpZ9 r\zߋ?LLKҾ3̂́,w\JV7 -(2?! Nnհjj8J<<:<:ģUULP׫ 2uz#vEoP^-P%vԽ>.CURǁ@<2Sk{EBFljJ4*&MQ!t0 ln 5{4xaQqI9Eͤfx]3%i44Z6,cH*O ]֔f3ķ&*fq9;c3<==bm)2 tź2]%q㊎嵺J :u0 zBש;V]!^!nxZ7A {Y7 ]=ݢn)f^Ԭ K˛7943z##"мy;Jp,G< He TpnģfgiyY/g"})B_MDF_w:I3=ޤ١ߢowwa~~xLxJG^?40  eJFC2 Aevw{ x!Øap0a`l^34&53,Q 5n0,aP*O[b,7V74' >ccFr%M\Ҹؽo5n{Gǁ'gjf6^7gsAdEniFbIK^K~KQKiKEK5fE]ltlii߲Sٲ{Enik9pfhNpf(NsiO @[R`PmjBLMA!F n6S SMFcN g%pU% MeHD# X,׋a$].qX+6*Qobb%zC%{VxH<ǁ 2pJ)EqITYxRZo(-c)T7dRgih,FbD]e۲ղ2`xÖx]ē3n9gL[f9p*±b5ۚgͷYKjk#6uVfX֘tiݲ6`uuuغ8BŜzz ֫[^<m Ma˱v lD2[m#F%[ cK 6z_l>[ؖ0 :m]^϶6$٘m/_!>0mv6mb`v6fiaıݶݵk@o[-y}]inJ^^^noO#gv݈>niGObw֞o6Ւػ[A>AaQqI9u}ROۯg`Ygξ``_vَu R^,¶?t$y[l߃ )KYm|>Q(-@n0P"E|^dC+| ISH݁!=![m3 C.' L[3YkE`.`MCּ֢֊֚&dXjz֘fuKk oٺuu?;:zDֳ[/o^1nzA:za`A #`m! BGMp)v-Ppo>f #xtp bp)ćІPa$T m ՅAi zi#)BƐ%Fy@n`$4Xlm6uB=}E-Ӑ:l( Y̓34 qAhى#̧&4V M`ܔ߇ + šY.zZˍ p^8_UERc$\6Նkᦰ.l ۤ`cp9mNG!rEGi4=G1 SaϷ_ _1/W7·z?0bXNl= V+C$nb*<bT K:c]X_lGlWl(7v v(v$6wW&cc؅TZfvn^lZ[VҚύoh)"2^h/]/W7 qM]@<OF\͑xw|kd9=>1,E_Ud|:~=> y";O%JDM>i)aKxD,ёؒiIlKw&v/9oJ$F'WgWW7w]ўӾ o{eF]ծl Kv_{Xw>GQ]C{iko?>~w>%j~xn$T&sbda$YJn&뒍IMҘ$]@2I&ɭɁ`rOr_]<<-MOL=iSד3\rY|\N͖9Nō"!UHUjR.eJRĉR Z4X#ڟNmKvvSS#Աԉԩyo92uInn1{I,%t0a-J?xUV t(:r:Gf1wLz:A쨌 Bul5OFw4'J\ءo:ҨHྲྀ>1"㹇ܯ{瘂_+c&>g3 =WbO_eVNZ1Vu/\rKrͬ$ג`Bn(3̟b7X9*qEe\,Dccn #vfpofpsOqWUpJ99q)nvrÜ}sr_e_}w?}B]}RS9nEv}ZE1qߐK܋Oɿ}^~S>|VSgq#_}Ik+uO{u_QSqӊw*WKQBAE=+E{EVhxB0 6E/R$]|>=*vT )+半/6Ř;]1?w)n(nQ?QL1Zs}~@Xwf7/fzbY_*<녬N~"cY{KYNޜR֘ɬY㲧uJVu:eYq7ʳ~uMVu=kVVӬ_ʴr C.Qr%ce4_ɲ{ǹiZH-1s=9F3zxI<(œa~LX]IqZ.Έ5u/&c~}>yѷÌ//1 ߂]L,_c9B#AY86{JN`Y+[dV({FVĞU*[embŲY+5eMX)yV/wpW7'ض|^*=)]yB*=%=@OF(>2=g-te# l<ڭR(gMpLzKh3Z,m %yR uf⺉:>E>7!Y9{'[Ǫ`bMa{G!5&aZhM\qe>`AždI6n$ʞf-a+o"{} [1k`{;lϲ}wop~`x]c _`b?='Us82lx.p7g|&Qe}LYgFe# GiR'ae2?{;W_ w9\#1y||H^G^Ͻ+/Jdd&kokoe/p!.Tdjs ٹ\vgL}3p;7ZU_Ƭd6vwMr̭t*̣)}̫L)Syv_ߛr`p ȅe e X&"w :\`7z޶[pU>տ7݂YKIw\{#>#>y@n';-B JpZ@k _W)~Ղ8SZUYկ'ӑ7 FLD7"LQ`mvF$=d2L$u52G%?llꀬ % ξ>*/J7*G%3\+to@pDg9s(9E &e ɬe_#XDzU;~#_H~E&eF}eٺ>fzyiFzUZG=+X\5޲M:6H۶HURi۸⴯8[!pN|Y5u垤g3Lsk }-S.bZr1n@vve6dكJs1ihgvpgѿ<;I=icγokF{Hx:{#ζ:Qige6mh? q2G3vzp.ጼ}ֽd{%Sұb#2{G2<,/C /I G$ eW1gb`Z~^cg%qȅRGЃ$ظ&V*FfdZy1bx1%YY ^+p4]r?b?${p/rt~+~l A?ߔ# GUƿ-cc9OMZ} Y{>!{=>/ôϔ/Qsk}gWO,yiU^'JT c=\,p;P09 @2Y(%";pe 2+T29T!uνp} pN8/5).%ciIk07MٙJׁdLcdrtua>*t`_2p=*ü1#AӫP7\_>u5v]Mq͢=P?kk9OjL~3R$\D҂׋c,l'fms{A;&W($\GܣcS I WGq)Bi Gxqp51q.= g|GaAuEҪ"!3#Gϸ4뉰˞)帚s[ZGYʬ Z]?kȏZ"zx]h@f dsp?֮%ͬ*x/z'3kVl53H(i}3z]2܁!C//Ary*9KdB?KQˤ%ƨg \#$u?CQ|8:j *QK|Q3|鷁'~J!}̢*GTrj;\>GD }%'T#RܧI5)}I;h .6t?tyڇ΍/7OHH}ڨ H% c7oTwhfgH1@O%_"Q99HW# Up7IWqj q*{?}>A-FKw']ОCgBwwQ -OwAO($ >IZy"YV]"٤N/+HsE"r*AMN^"_t>Oeo#~5"d!2jWKDj1_kX'lQ/fG(_0j[8N$bG,#Ŀ&~N,ҝuN񃴧oyz}GI_qq8OW@] U/r yj<qg8O@Z S-z yj<qs8O@D}uhyj<t%OΑerdݤWpRu7qU?M/?#DK/I<[=q(ELљLљKrt3ݷл׸OTN/gs5TOs?N[;KVőqQOR Ds=NPNwPP<婗ɨT.)zʩd{y}.K:5^gdyI7R $)*i!9%Z 7HVF]FI.t]"1١WI!RI'dte/IqY: ?A:AhK%OlN"TNw\H%ab?P;ˤ '(C)D)ѧsԶ0~zbLCOyHKqVF9<(ٰD'P&RI)}Gw>W<~<%ɜ$ H>U22)#ɕ02%`<10D#B2 $ FޟIg^}kZ^{^{.֚Ci}= 5@vFY%*.Jw^bs'X Q13N;911rhC:TV&$o" em¶i2| M9;V~3͊[ɮn4 lkO%7ۃ 7wMomۘ^2 yFN"=yŗVTোj~M7&<"x 6_iů0v|5G lͪ<B|s+6|++tw Xh:G}.v~1y#s7SmFު?x#^ }!: _ǞZ~?lM#Yx iEƸ&4͆s6at^s`k1}='}Usc+^ b9sG? ɽY5Bޒ;4b=$[>mJ_7Uyf M:+7'T\%;TrѪ';z; \ O΁2|$H:˵wMzqǤ m#yy m$LEajo0hەӕv590@QN;NPkBu\ zLU[AV;xZǠ`I= ƌ1r,<t SNwU{Uc*?P7^)}RV~.pb9sG? ~+tfݖ{=%K"D$w_}+}*%j5؟bOtO?yo> Qxා*M[ؼM Ibz/d]/Xu ObB]ޓb(w.}E+}pC\OD}FN d93#E[\lV Ysu'> XkBxBT) iU#m;*M6z\وaPXNY(o+t U#g[*i )8Bi辆BkC*#1vbc'Ƹ1vbC;uڄz{B:fFame_G%x EoFsV6Ҷ _'yׯqnB븡?cq:(9/(\tS(x1x1mU[ ]t:nU^u}P:'_ɚ-ftۡC/vZj(d\l;4`Fn`6,0 qZŕk|VqZ=CZC-Ŵ m'W(t%uGO/E3=XWWqF? w2c?+Fڳ0[߶9<8yd/vRhϥvXz條`oe`vXie`vXBJ!VDg&3~(W_XlRPX_/Z\(+ >\xWrr2 gO8fg~J}΃:*SL>?r)?_*XOӳәOh^Uh04vDoR: W #F2C"1ne%q+c,a[c :lEfVzYЮ2U =%*zكUHۃUH㿫HVV#AByD:QT)tj|Bgb<3ܪPOoX̚u{P%w[b|P"|ۢ>F1QV(rڟD: B`VKi$pΣX?ܙ2|BZszl)PW\fmѶlFVF4_}6Rڎ2"B{|tQl8EUU;|6tT;IacϪeyP)U,REj99rR9@x'+f Z9=t~x#VGĀReR$vM'(ޠТk [ W}}Kb)XUw|]J/'dl*YqgWC) [ M}M"*Ers4>[-U s\sXEPTN6 N6:sjNМعֱ4ndG]VȻ_ ${' \4 .Z=`7֔3XfEI+t8m}О%9 j Fn%sKZMQvP9nr`ndnv“ PD!ؿf53> jO1C+$P],lsJ9RY\Kf%&G] MUtW99kFYY5Nz ^e=BĮ#~aeic) #!|  ? D"FE#ə7B_ BS|9VhE^JlJlo\nxi7zkU9k;n3q]DQ zB־!s0݆y}ɹnbP>jUD[%xrozdVJq6| ;G+W{77{4<8Gp^.cD[r\s3V3 \9#@r[thV_$ԣ%'4n?i^GS[oVsU+t2/V^ qY0==`1_v9[-}{q;gv&k͝'Z2`g&<$k%VhP.%ތW܊W)Hݙ`snJp7w`lsO|fJx *('xV_&$*}5g~wM98+̙]гlG'>Ѷ6|;4k[9ӑ3 uFW;j17JgdErjB_ V;dt{}Mld(qڭfJݴm_89m[+=zinnC֏fY)fv۟3w}7- doUC&#}m+ g Z5CX>QXgsbOyz -sѕɗz6qGk"?,9`vX(Ŵ-b3oT w=<BpZkڵM+(z(p_Q qcׄBNwGz^O[_SfX'TSh7~bmRکP_~>r򐹌\NTOpg\9B` HQ2s57$P+bh:B@q{_:4O9hu~:UqGo9{"GB`B<f#&Eo7t_Cभsm_iGKIG\Q\"DjRg;1;G.{ZPHhsFg2?||.PB~`$?{lO#B}LH g8ٺڻU+N 8Kt0xB)| ]wC4 s=S830imY7 c^Qc"f*,ѬYcW*%v%_Sm\9CPA9 3Jq+7~uA~emO!RVR)x,cח z|G}GB{?W<)v I}[,(;@9_#kF~m8{ƒ^zV}=! P(dR|6^d/<|iɜDGn}o [ ǐ_B]| M_A vk7 I4øbf\렯Y&oBfSd6^2}?XXWB_i!wNb+sp.~ï$QP62jnjE3qxscq"g-_MW׷-<s: ޾:O> zN.GqWt |mֆ+M$R!2!z@̸Sh;Zk\,W*`m:M.x]bEč^" v#9Y㭡 N_~+жcc.3"rڡ;x6x6Wx "s-+<+/3gG"16Fn>yMӄiڦOpǀg.ct'OĒz<-o'{񱧏=cgm,f$Fm=L_X ~U( or[p mශ ~/6v#} O/OлAF!g4rFN֩ì9̚79\t̾DTDߣm?g]{k x@Y1Vk}y3ugφ, ]<_ j軠b%p#vq؇7yy)/FNETDdOص |c[ۺ.bl$2G'rXe 3pvjd#@hr4}=E_O!$OB'sp |DD|# ag祯rk\e^jJռeJ_׷ʾE RͿgJ~uwwz/1F07Ζ޼ſM59-E/+(*s,󻭪=R.w~)_f{5>V_r)9z~%_ū?<^=Wϯ:z~-_ǫxz^=ϫ xZghr37&z~ 7n:(o?yoy]ˮeeyV[>oyowN}ޙ.}~oֽ33Vw>y ^=OoX){ԺWz[j[e=n_v·V㠡I {^;{@}xAyqjY;}@8wSz@<ȓӿ#vz'3XI'd%^_$RT*5ķ?wgT%>m)2|>qxJd} sW~gW^ü֑ya]ˌ^'3:gk d2707vM;*䟛p/'-S32eA|q(*+kes|G|}RQOKJK)մܨIQjrJUl )QI ΖAШA>׸`B9Lfsh )KeW”HlR[3#eY2cEZ,-e-R3ESQ 뇍J6 +PKIEaoFX82,|. 'P&32;/HʻsrΕpy5\uו &?o;hS G5J8H7Sщl9jDn+kglXGDà X/K4%Z&ڈ7KtoLMJdAD\K L IzToxQEDY;È4kEg77&15Oz=?Kllx<@t\(JHIOlf-1%#zMKr$q"nDIң7)Y1MV5!%s7&-+ *)"~VKJ$^22[6ɾA2`Va)et%W=QwcJqR'EBr%g%&G'&Փ˒+kr{rOrpX$>^d K  M O/ >?NZ18X.JHO %G݃67׋;һsD}|a|b,&ƄzC#atITT8gejdr3Iz3 2-dYii S3eΙL"sW8Zd[ײ̠̀Р^Ff+3RqQ-_JM.h,LLLJvNfff$feVff6ffvf=},S1?s>+\w_Ufb?oEK >tA(xs9A3eMޠq.J@r@ H>/#>$ F3ږܬ4oZ|."+3x8|^ >DqXei>1NL}f?Zi'9A(9`9?~!nJnʸ.4v PJ- _Co5Jkk|;i? ;<Ǣo'ebyB> =!yNBmB5FƾfQ'򣟭?$$IHN\&*?&HH^&HDbnBr`#_IBr6Q|9 ڣO1< RU+_sWVoT֟,m 5#>RKXå %cN:ULs.XjRH]/uRwGuCRH=!IJyR+J} XUəfs/Hm&BiܟsCccqhcX0q|\bc6 Ch1qcúu%%,!KouPugٙINU:֥}=@&i?Eϱ׎/|oSGT@5Pt-Pj?4[f]Z! v]i\k තga`rc3'cƓx:Pq\OE|.P3rKUOכ}9ue}u,+5;Fq8i1=DqŸn4!c7&ML1fm晅|23dfYe0WkFsDl7w2}Ay+lRڪj:jVj[Vd~e %Ϻfݰnְ5DL1xIIv>\E4 ŗWLx1"vq 1p94!$-Yhji"Uhc7e Wx|"](2״D3xOҦ/yEn],p{pop" f_spU|u7b=[&1O㺍!#3lq`Ҷgj6Slmd@PWf/}e3![6*^ӬRi<a-=\Mr-s5>ǧז1`!XXaF*+3czx.LHAu ],\nm$Gܿ'fܫEeZ܇Ϻ?'s7,?bwwϵ;D({G cQ(5@Ԉ/h,{SrcSVJz&!<|W<EӳųE<_|Y$yZ<.j7eK, md9W{^~]C>Ob #3 FQf ݨ4jchl6Nc8h1>?f0NgEq7nwƨqH.3uQ133ߜczgM\jV5fYgfhn5]fY1e]R{-ZX4g<"ٳyC4<_ax5|,^9U~!QQBf3鼻dl1;^|<@}h.kx27eľ'Kȑ]G7~@#aS3Q;;]ы?;q'eYbexmf,:>ԏGcND-O-l~^\uUO[Xw-HN==CO.=3T=@|cWώl(1|F;HSKj-h4jZ=Ϩ{> #Fc?A/4G]F~oB鋯ӍVYgnt]N?֖y' Nb^f׌E7h2n0 c&"Gͦ04]J3{L7ʅnaz;o׫"loYe2",,5@V<N3ýN=\i1Wnrࠜg{l=\[u:fE/X0YCpuٺh*vn^GfduǺ 9 9xjO5xg'd9K>f4t5yf :Ѿx Xov͑Fˢ9=|ȃoxZ)<~O@T`njxy'<[ÿzwk=wqurYA"!GBBG޺o]_ГU|3w(ȿB8}lGZ_8F.nQqh}zM;mtw=Eo}ʝ*}pJzw*)iy7tJ8ldFNFDEzȕ@dz$2MyGpGKm&X8zPNV3}0vdRy~eяs$$?/+H=BDjU:R+hiH>k!+## gM-%)yE^ 7P^Qv {*|ᄲЗ]T\ _ #qX#ɈI #B0[YoۋtH!O4OO7 CI/ GkƏġ&0Ҵk !]KP3}O?{+uFzb[I;.im`1ȺځN{\k̲q;f+=T[uŸeħBYĥiGcjF֏[{IGf[g4?|'yQ13҇f j:qDZweC~_V7no Gǀ)"tP  a/ /X^^loĦ6vp-Gau';z^@S,쓠uÓҎhq+$Cڶ)D#yB`#eۺ BN]*~XoJ6ׄrہ{"Gȱȉ),EUX?r+r'r= uA#/WoL Ƕm=%Q_45FiDkzkG$V]-VE[md9o9(G;]ih^^\.=7pt,: p,-ˊ@zl.XQ4|ˀWFñ5:`elCl[o`1ۘacԱam`m>n?s6vK;]={b0n뙘|O׀in=CB@P^ T+>z`#&$;Þ>~(pL?/"/Eo_wQ@{OTcL9F> _s0ki7 Tx7tAkD #j5i7[f]@;3[DŽԦ0&d3L!, y\,B2V2ۖX:; b_'o@mKtǁ}8;y0m4 ;mK Y3*RI+%Bx{V+޻Zpҕf|o}*ᯒikʵ=Zw`ޯ.}=XYZ'p_oiksyV> ph" G}8e}(wԺloݲwQ랕[Dj52Y yso旂o^(b-bJz7NoWE8?=\hYA8{}rf#pQ8f=$y33b+{5I{.im C>#]9CW=Y `=v/138]GK# 'O4 e)l_to(!=OUվ}}MvN`p;'|; w \E~[;(p϶%;~j 9*h }0RzIfIJiPo7[mokUJklVĵmw &k o w#-x;o̻z?r2M'F?X.d: PǠ,W~8G_2`2?[(] HK0΋zWCOPN@}nĕMPG,W~8{c`9Xln [`v{oP*o*t6d݈+ l+e0&˕m6:Z8Ά?/pt2 82m^z[{Ey/zֲԃ:{2l82(Wzp*^ ̓e`tyr@e]Ӿx`uɶxH;L3ٴb܃q2CAve+{Z f. k{`WdP/?'_3OC]F7{F]|mnBytp 8N@=h 6z!TCALn{H" _2 t="إ@ U^[r2C݌=rӾr`e`2z؄%[߂ `7r%o VAObc>Y[Fmܴ߰d,  Y2oA?3f #} \v?xh]Gm`"x/ -^- Pϱu,+ 6)^x,Pں1VX"}%@C,. -1ꣶ>(I_ǯש/T غܕK;!.0j뙸_"ԸE{V3_pZN8\jv-m CC C/  &C]im!<iw3ert_BލV=}K@vW2L a 큎i@tGBshw3Fb~5`(t K@vu727m/l n00L,l *! cCǐ?vTHnVTss*k+WU*6I?3^ٯ~]fovξ z9eI8O()ـ$% ɵ!n2iңWlC*MH8_-e)]^zF]%c iCNĘuq?Tc#YUU1+l!rU>d P':?8*k;3m5 S6Rv8[?v,CZ9Jh8N)%?1IŬបj<ǻ]8T&0<7%.K5mZiI:#NcYj?\& ?Q5HF1wFdϘtPDהdnS'*Lq`nu'ސ##=xw"oˑLrE2F`A_{T3 mWqjN~=Oa21F{o RN|WQIjPΥܡ<%mO~/YQϾa_.2rْݼzΤb枧<Ė]~,IzxG8&q/~#V}g{02-Z+WtKc{&ia;7~zn0掔rFU*.P2I,g䄛F[J-zrsv:%=(}~m[xu-{4G͟OșKOJj,;N2FJ5oeYWA4N^MBm` ;h&>)gWB2rKp kech35쥽ku/_} FJJh {-_^m%x2硶_uWJ\f e|5xkh#\ars GLl^(e.Fn8y8<ʹ"J(wSKO22fea!{v{?ۥt$]ZyjuhX6Ħ8ͻϡXͬ8yNY_baX)v4ŋf3).42(3LL1)n3jb/SeL)~2L8l62CF=Xߘb9b).1EL)05C[yl0r)/K|)F@E6/D&]K1u).ΥxlF.JaR[sf"ϖRLZCKgټY1 CK1`)+zӕRVJqY)+_l*j8JqP))wS64SULwyRQRLQ#fb#R,Pf~ROyR O6buR[d&KUK(y0e$=yx<kjOJy%>̲jLCG,H-%g)rgPS{gΑt\dO罎Q~r %ϙi>E|6=;wNjl3^2)y¦q9 8wrҸ+KzNQY:ww EzԾwx6W;;8= ڽ'=ܵ4G6_k~~_'r.d'^q8ԯK%wNu2N95δ$n'[ѸxO\e.NoN3MKj٨q>L=7TsuiOSJ?w+!ңikjl)>x {vZ.JkE8f885cl}G[+`o0& cu5G^QqlJqxp4ЖcҎg;_ .ƿmXxpzu9,ۑ[?%a ,8ο'3*,9FjCI*r|p&$єƿHqڜz ǘS6!; 6p*-x"}/ː<Qk,mwHC pHCAC(@N`D>1&t9a〶'2$<~r4>8{g;%=(/g6 !YA^@ gpWiH siV:1ji j^ki’q!oC O 3| <_ÞjIV^RhMMV/W_/)@crKbvsB"nh!Y ~>H:pcQ߂ D]  |xr,gBY7O/!y ~~%zxhR&J5̵0:H[C~m7C"9|~:ړִ 6wpvY]Oj Brw [6_ "ԛL؛u%}ÝFtv&6v rOtmoqѲE7(w@C- *C=-tYR?WEVҸN-Hk1I~Z+^|6pp0"!rO+0I>Ǎ{b݋'#eX`w@NeRLH>el y h=& ,O%0&s&Ju Ky<9LGρ䓙jyɩ7\nʿWM8~c"iMwb}̘n` {y&8`lY$mZ el)E~#io-O }VrOe/#s-|un(Qc*?i!%R]WA u=[I%1(b{ DGלm,SVU͘t|qq qʐ܊9ppU؜ _@_s ǩƿ_pS߱KEjg~(jQHU긽x[`@;A@ly}HZH| bT;i_UːivA=j h-ZO|cݽUn{ Kp'i@AzL][Ҳw-DjF7 rgo%` s[dL<mm<ڐPhehwW)4g+;a7( Ar5oy@g_^ JVhB/݂^tfۿ^@@ZK~ZqXy^RR_+yNp_}5Ї`K?\Wنd!Yq&<` 2}_v/dIF' <,GρN> X)f!6;/YǀO@la3f[I<$=7 K7V zB܃Mq7̀ N^?6'`N k Eo MH'zN:c.4-v\d(vbAJes]ibт>Q[as>nچM/du90K鮰@1+)thcxKq(oUdK)L; kY1h2] $K2V {6vj/ȏ]q6;FJcc2cbܳuˌ5vpjl+V'&Sm+Zͱecu$Xʉ [ؒ !6Qckcc5Xcpl80Y ""hO2@,1#!c]btX9;sww}c\pOtuOr^ijZbQi [ht-Xi$̤T6K]uү :'}-7:]|oħ׎d>RהM~_zoJcIߜ_+/Xԏ 3rJFr{:K|budޱ}ϐde),S*|O L3fbpְ:oAaq>Gtӷ?t*NMd9]LsF"9@7;G.g8g99Χ EF;_vߝDkZs|O_ PF&77pcqɨ0*ƣƣbxxVk5V55Qde%n(61ی_;AF,4ZOEq8%ƺ.+,ƹu]+vv!ƻ&#&*\]]])bWuՊ/ݯ_|Zot bݵK2\SFQ/FGGqqRD$ڰdH)HCK/ H-K)V!ͦ3i\Z%6JfZ;6JZ?NH-q <Ƶ y%y4g̣>oL^iR敒-[(y啑d$iW;7$dۇX<<2t!G'h6Gϲ$J3]j%MEq^~^?xFyt|#KP t <^̧ {`h1l'`/ ԖՌvIHeBj6RW{TGrEWwUAD4%'+җF.4GwQDŽ=9/?!Ԝj/Ӆ.b(T;kkv~/%_O+H.&_[2֭˲UvOSH+ܩVRGEN#?|%>!i̝H~PEÄH-.GetT]nF\З$S4D@iC9/W=stR_h/^yGsQ!RO-%D#PFg%v"%SQt=ϡ1>5f),3Ű(:ٛRܛ+L3Ke/l$f9 OK9\D~<]'h).L XN-{(]7'R.s7BJ匤WNg &<:zBtjMa?>[>h74iJK,zʼaGKEg@^(FH GEK#C"1rLVhJ2IۦĨ1N)DxW/eWLzBSz{-b)FB|up>c }uBu_*l2PB͡J_e XhÆJȢ]hiC,WBڦT@.TZ,o iwA.4jYpVҡ7B؅C ̂E<m6\ h}ېrl v6ֻP]2uK+PwA#jgV]my  `kuB #;\pPh ^5^Bh AOh^Q{tP8 "dOKgP#`C<4"{vv xh5z& LxI ,p̳ (Add[f G)WyK$O< }[ ҫK+@9< ^2tȃ+Z.'qH2}4Fzo=|yܴ lԹ.PbYXfsXxƽv)gb"")榧L tS% LO17}q2`JR=4;CH3?p;E2iLkfKfK @>ve$߅H3enh;!/g UŌ#McB̅mG#̩S MFۑfݠF? 8/TFۑ<=<¤^._$+']ƴyVK|:ܝ}rW\lV1Wk f&s+d͝#qy9,9+=[kzV GU"|B{꺸B7tRwU!SGDS/п&E@F$Bu[ [B]/y(vEWjW̮f7q)n5fef/3(JLzc<@e5&ƛWĽ5 q9ؼN|K7Mby9R|ۼx3_J :"+be/Fn='S9Кkڽ½p w{]&VzMnzڣ6_9uL=SȺW EGljl=[8ztZ}0 Ӈ Vzmm>ZCп 03av7 4ݦ)f ,3dc^_̫́o^k^+zC!"h3o!s9B6o1 Eg-rЎ< 9BRT !wO 6"䋒G'c;w/sz)?Ngtξħ]ԉuw%r1v䚌cF3ɚȷg .rkre.u.8 "|s t q 'V*!!k\Q< 2$iJ,\ckk>׸VVRzkaI(bٴzJ$Ɍbq!uG\i {9]H:εlg)6@H+t^{yh;#F~oĈ=#vFbأ0b}Fob^1bcĞ{ FaĞ $In8[ELyWoEMV~#qϧmN|pzAg9Kou"Ln~ڶe}F#s9ȉ9ȅ9ȍ99ȃ9ȇ9ȏ9(9 0ޘ"r0b?;wv^{'(Ea;c98>21p4&v񺣑 Y:}WݶqaMFwo$_i|6'=僴HSe"yƊCӊ '=m^]%2WԲ8,F1~I9uG KL'0wr,S~8+>&UHQ>ug'pZ*zȫf&ε,B$ڏqIyO Uo]?o;w!,| y7Gy:dD,nCP2$Yu+SgsNwg?!Vjtvub9x/p*QqRqlɴdS>ϝϠTƨ:w+/.ZwrFxz-x!H yױpڅf uBO;ğO\-D Po\G%Qx79sq?Qi3:]@zw0O`"SŬUUdGx=e1ֿ[{&}@YsSE\Zu.a;S)ʥ}tY7𛊮e}\boړ{ ř)"Ω#}he Ǧ܆l|fZ|PLc{3מ8kLCbN. QldNrڥ<+^?a9wD*}9b/ss|ck%yC$DMwtzj'"IIMۛ `pv1e#lӬpTy& psHk$NoZb%#7~[ ;!iqR.BO - c([j&!Ya[HRIg Q>Naݞ%S$0{RAZ?@ZAZ?;j w `&}؅Wڍ7񸯩&6 MYI 41dޣ3u[<1MyS+㷭hrZH~2Y6ngmN#ʨ%m.w=r-IN#*F#6H+(7 - 2v*!Wq.3Gsc8"u|/^M!QA Cs4.prdDX6DI*-Owrjѹ-_9A4B8:ߴ窅GnM~8jW%ǹ`*⍨BzIKLα]v* <:{Z^;iaxR_q nTb~ҹٹ};sE 9T#ڻ1dˠ/,Hܺ *zswүpeDw\8ޕ-,r9h^#xHvmD+ Hy:# bHZ7"E*h~bgLxc%KZIN ⬠ՐyiqDSӝ}4ܙW3ugo1,IRr 7da}{@xx7w!nD˂"Q|4l_wUNSV ~S.4Ⱥuf^N싅qKxAF־֤ҖmG% .IfOV}Ir#xښ#'\]GY*G֍[KXRo>@^̫m@o4DCY=@4>"\있\G :y`C R"ڜ}*Bm-:i_:r{ ti>̦vWCoK0']:wvH O0?a mpHfWͯ0$?s=<}`sLK0z!@FR!ڷ*dıB?ӳ~xއntKjGBO;W;yCz%]9/4Z!TzuG-:4yȪi737J}> n|)g$g 6ԮaO9ՙzʪ.bTOr)՝v.h۶Cŕ̺8)v5Fk!.6waلzJ+/2aL{'dqD^Ǧ. dݾ [9h7q*+xkt˓m,(2u~!Rh4=]HK͋Qt<(Z]nbm'8[Hk t -q,8Y0W3pBˎJc<s0p_;uyL3|xAVRxoԼ'.f]\9T1!8/TFؖ(³nX)v'íTPIO:n 0.ïb #Gjcwִ3P_+)_L/;jQi4 F3ڷ* @ "kQ+}|0咏M^v.aǐ5h3/2Pt rZN̯\ntzag8y .TI%gmq|';z*nKe=oO%&U4:Du[7O75Pm({ ,U! ,~ҝl]X#GeV{+e;cB'+l=k1frL7,%_<3Ik!l#gHA"=CXk|IDxM8

    ppSӎ,I3\o;x+]2o΄D--&m#o|QݛYHBT6(:ˤ{&F0MiXd;A7P**-їT#mƆ/Jeߺ4$d)G GI-#mDQׯyyOcͦ[*O **<Ӈ8\0~~o6o!: !MU-s'.t>3K^_C1[ E[!9H&@JOQ۪pioe->?^z}M1q.mr&N~ľ$^rayX/~IIPО;ȧJ|SnhWft ea%U+"gbiaSQ^oD|EE A&o_(Tޠ8MF8q:RMi+0e)m܊nn2mjFWc n>ط릎U; ٳGOhq@SѴˮx-hO5:N (ԳlY{vͪ9\ 2|+M ԓW֩` QQ [f?HʻLT|T5`(\@Ѡ`fvZ"3EW!S/h\¬Vfs צs);\য়VMV/qJ_\j__p~j7F{xVʅ}6-:2[HSÓg)Nf endstream endobj 87 0 obj [ 0[ 507] 3[ 226 579] 17[ 544 533] 24[ 615] 28[ 488] 38[ 459 631] 44[ 623] 68[ 855 646] 75[ 662] 87[ 517] 90[ 543] 94[ 459] 104[ 642] 258[ 479] 260[ 479] 262[ 479] 271[ 525 423] 277[ 423] 282[ 525] 286[ 498] 288[ 498 498] 296[ 305] 336[ 471] 346[ 525] 349[ 230] 351[ 230] 361[ 239] 364[ 455] 367[ 230] 373[ 799 525] 381[ 527] 383[ 527] 385[ 527] 393[ 525] 395[ 525 349] 400[ 391] 410[ 335] 437[ 525] 439[ 525] 448[ 452] 454[ 433] 460[ 395] 853[ 250] 855[ 268 252] 876[ 386] 882[ 306] 884[ 498] 894[ 303 303 307 307] 936[ 507] 1004[ 507 507 507 507 507 507 507 507 507 507] 1081[ 715] ] endobj 88 0 obj [ 226 0 0 0 507 715 0 0 303 303 0 0 250 306 252 386 507 507 507 507 507 507 507 507 507 507 268 0 0 0 0 0 0 579 544 533 615 488 459 631 623 0 0 0 0 855 646 662 517 0 543 459 0 642 0 0 0 0 0 307 0 307 0 0 0 479 525 423 525 498 305 471 525 230 239 455 230 799 525 527 525 525 349 391 335 525 452 0 433 0 395 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 479 0 479 0 0 0 423 0 498 498 0 0 230 0 0 0 0 0 527 0 527 0 0 0 0 525] endobj 89 0 obj <> stream x]j0 ~ Cq]C`kn,8(!o? L`-}11.ae0I8oޕ&*-p- ƠK . xT ^~gj[p8ʠofF;uNt0-"K_E64j*gV!N 2OUP{,yJCT>? Io+ endstream endobj 90 0 obj <> stream x}`ݽO;tTluK ]V r/ 9&c S" d!B:ƴ@hy{NA' #ݗ3;oν{owv ҐT7﨩-Oyd>0~^۞9 +lٳ-q HS-@vPcyےR2k^IٿSɈ4Ϯ>?u zh}։XքKW/^^: `k0dCSgvֹ+֮\;mȕ׭40aywcyΕ'o\yٸ}`{ҕXhժ勗aY"^??`j`<{>\݋2k.~[li:1  OYzշ< k֭WW+Ӗ咪m ZZr6{ɫ^W|嫕=/AfgByۗ|1׼`8Xr+&p1 cn'`VWTY+t2hP~VHnNIL*Z^3jC <{౬0Wwϧ8ru5Vӵc/"m[mPv4;gtSֱelmKbp-n-(a M`n"u8N?ٕ˚ yBF4c V_o2V_u?!kI~,S֩(Lޗx|M~~޽׶b-ۄڞ .0[gayoLdr?6*C =݇F *AV1\A<\YP6B^k4wGТ{p3h4~,vu%6O gť4>N9Uݩf*(o,e 0SW?l:a!LGÏZ[ nR^Uo׎3J 6 7nٱx8?ti"^G.`?_8u ƘAz= zsؗN PIAK51ЇyVE1 &.DU, `,2lqg"&1`,b2~ƼX1+e`,PfΓd[ܤ 2]|,3 {r|fTF+0 fd X`E N;.\ꗐnTHA{!U|EN#9Ґ3 ΄ sȂr2Cȟ?<!gC9FB.D y$(Q \# ` C>r  B!h(B.br(A>J0ʐy X8y~yDDU0N&x S` `2QPӡyLAI< "φis(=K<V|h@^ӑp,DnYM0y!`"|G>@p,bhD^B2X!$^!G>O">#%ȧRXCoé4Xx=B>N@>NB8Y} 6j)?"1A U߄3T4  φӑρ3%>~? F ?Bn䋈/3/WR؄J| 8G yȿ$?|_#~| .D.BjX.EZ \ !o_ o՗:KW7o$A ~7ȷ C Bm{ kow [;:y [w# 7 nD! 7}p3p pwx6䇠oay7܁ܩ>Bcq'`p4<w#?M Q} "? !?G<܏I}^?#D2< ! E~F~ v#N<&<>occ6<? }(쇧%> G~ECx#x_|L oxY +s؃E^EWAxY7|R0#=t?E\H\D7^H:tz1c+P:}42HELu}IH:CNt?HXG:=N?@:N?@:_I't~H#t>H#toEH:D'N?ttiבN_N t%~ .twNM:}7ݤwNM:}7I?6:cNwӅN:M?C:ϐNtӤӟ&t:IONt#H?F:1vqXlFeY7i$w"= F`?!nu4A&Y["Og%%tV֨EN @0|Ȱ4 6P:h2d2Y >:4c=l0 d M@YqPEiғVղd2&#X\z}qb"! HdZaK# 0\!|dNZӑ!d7袒`2k#7 WE b}Y14@8$2 pX`fatBOFZ)V=Xdޤ߂O}߄}]osq+0Č$A}פt/fhr*vANR,3?Ϭ7 ID:.7:^}8K#yinf/Zk20d۽v]Tj1thkaY(A ]خU/)UTgLf ݛ}Z|gU;IN\qCd ]s Qxn:^3m%G!|NhÐ;tQu:fZܤ2;lv+`S{%b}o}TQ}d23nz!u5^zfbi'NH– )N] t}*llj(ؿH}DF[l^3m%G!fwDFnm.;6ͤv.s(2q0ķ ]/Cc!O[ԘDffF(rη@ Y; p]qRݥ8v>g6ٍ RID'58)f0  ?8:aF gx`ȡRRSCf2l;Np:6Ey}nbBʠ5g.@oƝьttj>@&x<)niKyzt,xf?N<$D-Dsg2[qFG<Ӵ7,h9 7 9ᵐE>b08.7&Nq(2q0dڋĚizp`N"33}dAv̄yR|X3zv,2.7*S8D,q[qapQ{V -wzV20KKIE(VNIu;=XqCۙ@O1wxCߠ$sfoZ75|{ciRhsY>(gL80(ؿmF0uyUpiw<`&@.>@Z  /|nA6xi'gd}$ 2 w)O 5fs\ `b" $ƬKq|"" =5-w4N2L,7=v<)i+× _ !*ߵ%3UTh2C4Khoc}>8k'@zD eK<$k\,`|"o'ƪKq6{d 0faYp-EkIח :IJp紘|it'VMJIaQd `s?Ěiz'Y\B9y@W}JOOtG% lRz.dc`w)>ŋk>[8 Y'=rUp8/ wG,rrOCkM‘#\dbYsYt_==,~22x 7/5ѧ-KO> k2]p֜2ggyo C^0{d.=~dy<"GoŹ\sq+wG,r{:Zk)da(;7glN X62Rl@ +@v0z`8i2t!W5ѧ-KOTL}ov+pY+ ;//;"^VVɢg-80(ؿ6jCh0@$ϫL䳼CF42L,;_1+n YXd=l0P@a@׊7>TQ}ڢdf+f[Rp8BxQ$4"E|XJ(0{P&ŵ)Pfwz> Q0h/HdP2N^KII F uyUp BZ󒹇‚/X4"uBHv(3? A$ DjD0A껎Y4vfo/dObsrr v"PTZZ4g9UpD`$J;"%'N;]LVX/yɶȡn1ҳ!"h--/Y'Eƞ9*gD,U@Ɓ[`l`\E5gzs+HqG{A"o'Qz+.͟;Eۀ9-<2PŘƪX)@ sGy3ѣxTn 8i2^LCF(/=Y0oD(q>b(欭3*Ǐ,)ɕݥ,^\w=x`|"' CNﭸ@$ 00z0@$ϫB Z &.${Vq..]^_ Xb(+/aQd `gcs0[F3M}ڢdƏ;?=P^^圵{`BM̈́i|)0m`fBw)$7u,N/`|Xe P3{+.+HEUÍHh(Rֲ+-?fJI2||/ʪ@A͘PU^R@Oɢ!Ěiz &?)atat`,ij'~SKե ԫ {筽Ws߾W^[7"NC^-ZCWL+& <0[ Nj߂􌀶DRrrFǞR(]F]ӎ+5{yc*Y .e4Ӌ1J:$(Y0z ǍSUyeKK GɎYtIMqj1N%)͡hnsTɍLVx`q܁hM) 5Xd5J/jMK9Ca|Qa>>Z us1|q])=@Vr)bH89BiBQN9cUK}sf1Fj lCQ_dmMd|c$0ڰUH]}M9Egi vidI"5QG@-UF TM~:pa𾖋:,lƨ*z뢾ݵǧf-i'xP9aMMXr4L/⽘V 秢H=?|b(jDV،$% s7ӫw{!>21Nʈ4- B܍!ϔ6K6#˻(D<0;oQ(1'Riy,B1D\exNj[cq?qFB-^ȁw{Y;q~<Gp Dž/$q"ŏ,*~KI RE[;(E3wI۰ cʫ;;=e|ngMvI[6}(Eɘ}k\~k>sN&>Ӵ٦Mc}i9۲~o^6V9XSڂm|؁\$MʷldjL<e{(m&n6c{~Azr%E|<$bG,u^ۈK'"^CL~~cP ȜkdՅ:v2Y+je qGӂE낕 ß5yn|m_oSԞ?=8.WW)!nj~Yi~0U? 4xW܉RW; J]!T^{#!xr%]%3-_lD Q-SXzL``u"ZƳ<-X FimwwTK}pd3UlhкzuuzZbh-0Z3 FiFhdcjשz' gn/3Jp4DSa^ k޷`fT_H a~MZà΍V4D %Mx4*]a~cCep`'^UygzMM=cR$Dט)uPs V 7īܸ`7O ^^R~ErW9=6j#ۼC~g4A[oktl <3azlU@}yXF6RitEnz`IFȅ)x33Ka74ʃ\|#`2x6nxބB*kR;͙PJh@3 ڤE8)*B?EJˏق"s1?aylN`װ/%4FET#S!oo_*Ӕ [z:RmPW߫ba$ 7^Z<9p^+s;c/<< {o>evVƱl;m@}t;=ΞKJy!ֽuleA8XumSjf<{a9|\o ]zĞ3ReQ 6a JmdgKX+-Evl=A"{}>žn,C J#BH*fJ+Vfvn; ~(׳kn&]$$mPXF+^yJ7`G\D p Ѻ;N?zԊRȕ(~ma?~;\lߓfz;a_I{8zX?eۥn~VIc bײ0C:6++uϰWX[Q )EkhnMxET*5pGO~Wa+7H ; 7vyb!{ nS6SjW'ʭrB |]ǞPwIBJv{nW F m&OA5>o9Kl$̔FIdCH `ȃm*&؋ v)*({:~+N&RtJ+!3:.jw#Ko/M6mmh)Z61P@,E@.신 AQ@\( (uta7UgYuF`/i|w&~=BR^1LTQ^0ák%hɆ,t=p 'i~8̆ND%~g,Cx"2,WןG Ak?+N`S/'Q~8?gxw;Qj-AJmZn B.8H#%RV"|='eO9.P^oW;ݸLC瓃wӂ c!j<TEbi"VmJ^\s,f1&c;2&pD,870>a0wP@~ :*#HnȭrcUZ*pD,څrzl05>V4a#aJiDYÈ_n"/KcDR )j1Ĭee%<"نxdy k WG<sk>HJ=Du$iZXx I~*F0 !^@:+6:$jBMf𶝏,{l|/WZ{~p<OwU?KE4Ld ѱB Y_DL yF#=:_GUYP_j s+mW9gtJk937MI[+(ֵ,(L!lLK gÜ9H3tJ(KFKuQpϸ(CCø\?ҏ&5zNo0A<^S$F9Cz`zDCQi!MߐheQ#Kcw4hjL?#ڶ+%)8>\Yie Tݦ }Yuy΅^,}w*,8>vf2RˍsJdp5gy}LܪGfۦzkj}S'g4fYlI{oa\JO<˂bs() 2#J >l4UN (E`E-Ғbaxc!Mӧ=|{CLgV=$Cxtؐ{7n}ӏb7߲ |"Es=`D  i3CqU۟TLmbf<ib z}ql lF)|5t,R[E!Ѹ*ҀVt'!:h8@!A̜oY R~v)u/ꁋWQ82^|fngϾweYq͉wՋ)..[A砷+]gM%06&וtmO{Ź,N#l`djq:6f)(Ž-ذ:҂)FX!4YV&5[ʦ1j8E5hnkަaU)u:KIjIsD @a0DL >r9bZHѯ{ nvG|ھ&_Ysu}V aV֡C ^V3_LhR4߰@q}Tàyh$,e6 ,2~c3$޸'$^*AW%? 1! sK!fo?kw2ãSמ X{ ͙ZRAW jlD9G_ʀx<.g0QSzjJ)cP@"7sIn ƙ<[46-9뽥ԒtW.':ii+|OhڣݮJm3U;pԨڥ_hiMNWo=g<#VxǢ-oq&pȕOmKz]\ &ܿ}vbGQϹ}S@EEWdU!v&Ya, }V Y eqiB\7P7] KLe W5~ Lx?nށ<ќea-)܌4GnW4rD)2]#`@Pfn I+MHƀbB &uXf >^7^5c ?ӈ/xS_ow{U̟4Lk?k|qӺ~0sAʃShJ6~sY- \ YӤq?Mm4@ȹ|u)d[fМKu))Ƣ?)q6Ȏ1|~Uy*bdipU 1R(?V%!Nl!3$es(T\"`C}odô=VHEH+?w|AXCE<5! 4mniK4:QKQ]k֡#tXZyB;v8M-G}J}UVFmj#YL8V$"ي,x:7_E4#?Yٴ9#/[>xe`_W~A]w=K)ϛtMs\=Ij/k]϶O`N96}N7#~f ~??׃}{qPEoE>F*rhrCyft:k 93¾ܲۂpn.b|A\fIFz0lE:WlSLR>U4j*"m|bzzhFQ~X)6LIbK:t.]zR"Ҏ*`(d3\Hf,ve Ɔ I 2Ⲥłp ~ɫ\_oT_y1iz [YgY;2nqKu/,fY뮼k[DfB>r[sPc6@JkKdF.7B붻I=.W2dVNG˥' |3Ux Y5cORəEQOK7.uFK>(IF/ GȶRe0 EY޺[zY='Pz&ݛ/ aT:]|{w?~~?G#x`~``Wdػ߰fl|~8p8 )~AÄ`،t|LŒNep.@ JkEqi.I)N=Q )([>Ep6HETw|Mc=v6;7MpN Ok u4&ހQzFHӃ(dB Ndu&#+\PİA^ H'x̷8.bVt1B3݅4g"KV͝.%Z;H;E4Zb$ԃ*n\fP ]o<QQrM1%L)\YrNgץaXw ^$ӥraYVS̯^3=@U; VvƷ|:Fp~/ѐ)i&CJfpT™^Ə?!v! [ )FAƘwJLz!/D$2H^+ӛEz10A}J-&VDxXg:kVꎆJR~KeAZ 7"[h-$hcoSO\7<~Y~Ӎ/?!}v:ԯ0:Gǟrl~ _ Rf/Ue8oN6Ǵ;\#F&E@0 BD٥)PJyxśw~Ҁ5}gAO0%@ ^KV?\OXu-PܷOCpHǽŶ<%MЦvCI<'i[E'FwԿ]^¼ܤJ7zq)S&aX)c[cfub4Zg]l}ĻYiYg}7{Km(u&j/pY C uL4jRadR?v$eB qt:h$YX$:]nc-7m⬖@ +etr:Ccdp"z}A $ a."J 05lX "zQq jpvoDIˋĴ#[;+FfEcz^}_h -b̑Z)9W28ܲvUZۤ+/=T@mdɟQG9Qb&E[2x0@Om^i)Ig|jYzzwՂo6 hx\^`ߚ.DeSOwO_8.zosG>̆?qɦf~קꯏO8 1bh%aYl[a'n*nM"XV &4cmQhyj' =|ugO>;tpײϗ<]ĬUC5Ԑ=t["Z++^3R#F,^9j,ryZf4-ȏq~_<_j>&Yb"4j2`gX: yPIx 2`G%ٸY}F3O}\]ǖ2ܝ8>SUVBYGeYk4&Vr6gۜY.WjVA2]VɖrK\Luapqf@I%\ADs]x͡xSd$Tt|;}bhNM9QqIC7 Tq QgCdzmD~YW>x5/c9 1^ܻ֩cD0a؊L6C1 }q/AmO}mmf|~z]u{{gňo`-)˻ ~zrEgƋsP%ƗK w^_Po_ Q)M#8B)u]b}ǭjwgߛwP9w\Oo̲(E&<ƴLҪ/u--|%vLuK6Dd|Y Ȏ`d` #o6k܇/~q>FPĦl\xDMp4W{ޘFR&3IMv&_{wM\.$%F<[o!ݴw:Zz+ёlfkjӇgUo ^ѳnWa,|Ʃ&N~ <>]yg5Vmݾc6(r>-m;j1?_o!wuowľxstgu FQ7?k@5O3 5H%" I>c_^Jlj3l%VSdu v_TS<~vԟξG~xu׬YVyVS~0J UN{B /b:( Nɞ'ow( z.W8>m6 hDi~Q0KzL9<<Ǽ̚[pr9q6J'm xZCt(N!@}ukH"6{P?ܣv)1U+=n3/~j%>>g阥\}?6 VLt0 "IQ%jar^4/bbNGY20e<,MX6[wvQp3@<Pz1ds^Y9$G!w%C]g#*irS,v!^8GcFx|ӞEv5 њO:xkx@熍{ܱ/<+ocs!q\hh8ZjeX1:N g4(Y@p%,Dl' a 6̗!YCt Z%~%~-J% ~h<'ӛi`r,@i b Dj Z$J8B ~wS?W2O1l^OnSm>2'N~-saEFdžKŏE/FFuxCDz &b^B#4Bm6+ʘJ6~>p)1KX` Vc]սn ÑzډX*UEqxNUzekϚ$Jp5|)K&Ϯ[E;}kzl'q{jE -GAU@Dwv5sT2ù~.5rs'@&.C pIkF5 :>Bd)̥@?LO'v[@m^4qi$_<@MA% QJMχzCۑw ).:}AM.)=+-@ƂΆ%ӮC9_|਋/UHcSG xg2nRЉ71&/|$zhzFFf5dll?@0TXQLvh&hɟ.gdOk|SXTG0om}#r᭣wp?@ r 0#C FHZ%&2\)!0![^hξ11ecdӔ+]7y;V:6 Lyx^7ٱɍ/1e/~ .2B.DtRWMźEW,'tG-tg-tX#I1MX6 7M41!ȅ-b6n2bMZު5"[ȭ8}D\k%J t۰~^̝ydҲ-dsx=HCn}Z > ГP-:,&̹ f.GuF|y$` 0C9AO 0W`3sElD=ރ[7*Knw*{m|?n͛71-ޟR;Ƿ=m0eƑ}u@XU%`1ptg̃\6[d8 3'I)N'ƹx;%{9x &Ow Z"K*|ʲOz/,a$/No *Y*-HkJBPei8Ezi[ENQdImnIGEs[US: y@&I.*)d?eSgfzDݢ7-yC;{u񭓆|nj? z<-2g34*qqMNnioU!a;.%b 0b603'"1Oh@FͅtxUҿT-k9ø▶KB+ԅ ؃T# S3Re\ yͥ0w $pŤ bw1thgbshX7Myx4͠S7K1T6{`sBfgI#k nC wJfEn[,610Ƭ`f  L:d*8ؕeCYy6|\@k><(EE.t-g쟜]V^ 9e';OUJt}R5ym;0vMz'OM4*Fp9x7l ҼdKP#37gLseՋeew߲oKL^ǥՓNnY 4 ]Y;ɛ3kV?.zޛ 3 , 0, 0 AE(qa\pK\&c̢YL&f IR%mDYڦi#߿_E^λ{9sE7̺wl{run gN7 { 3?>R`R0`9C؁^㺘>AfpR֞' uHkR4)>VS'O'Kf Y|T˧4L̡ғEδ9QZy:&_΍`{6R3Ke*LBnȖ]mu%}@4Bp]eWќU8ZV;<">=Py`\[\S2M380V p+tNr80][S٭jMn=Nӭv`Y3Օٱ>˾a 0©LԺrSC tcnlBXMYͤV:sVMK,7J*H[igl1V!=W6ݓ1*IK?eWHyӷ06OE@/ҖamvV69Qhb1D:,*H@Z= "uHeTF,8lCu!Md'AGvTv3~vF% p|77O\`ƍ/-~NwP_d6=D_2J. YNc9?4l$]$lRSX%z$,W%|k'z~MᲗ.Z=+L [jVC8amy <]x蝚Oޏ|?J>twPG P}_" pGBw,ϯů:}#;m.iMw  oI\DbG ̰gX`~J.W"@f 0CAXz}!3[k'JGn3.҉" ~N x*lx2wo<̩SdNy\•+Z2iQ,:!Sׅ'7`X9X!@ Qs@+E@y ((eb">DIC)4]$*7AW3n[8KYkuzY9_+A{-Hև!t/z 9N~[ĚcOUADn; kH=$+9 ؀qp},c}0JG] UgW?ͲT:ZWH}{{\!3 <[ɶ)J$ڋ}~!5g)s,Ny{+Eazk&. .>嬹Q(2ʽ{i󔍯i}K̟7{˞n S3ӂ%ϞW_X8y -h3xE|5vSE#J&Ӽ7Fq+QM{Ǚz$|mr (;?E(mȤ Vyʨ&KPAۜi&ސasOl UZ߽a߾rۦrCE9qI0=Whi[;gBCcNqmmA~&R7mCN/7~nx0lEmE;waKWK-nJԪy&%RJ}))R. b4%Μ޽fҖI[6jΩ! 57;7׷oZE}fNNZr __|"Y7//B/Rtץc2.?HœL!6w4]9ycSǔAnAA]4s /BH0~c8܂|B" ig.qwC OyWH -l|`%`Grs KQk9|sj|@3z0jL9:LKZk5Ss&QxwrS@~U#wm etsGj ͙g =տjyUjqru5޶x񸲦=sBe޷h "ϡQ6)!?z|:o pGē}ss[t_`ÆO|&Q6YZ=ɉ$9>']ofLW7U:C?/8 0iqAK YMzmMUWV,|@K-kg,Ps[ׁ;*;!oyc 3߸75uIu%wԶ.Tv${vzpDZʀyPu8OZsĜ(m7%OyS\]-^}zjEs1g0ŷ7d{YX:KC*ڰic0P]^(ʈs_Xj>B֌ eKgdŦgw6Ew^uf>TBeԳ.,Ky/ }=r M5''ÑmM|lʑ;~o^" <j*f5%5iz1-V/62n,˞leHxc?O " }o1t%=Q ;+&n7ސ%DCFiĨ"9,Uqquq\\5LQu7dVd:uXs;@cw~4Nm~ [qςy{;Ӯ 8ԉ/~kR~Ӿi^4ynY|?K5ns?v/!]pX BO6i:Qs Ұ@2 !Ac2e ĥCz~% 2H~;E) yP%e`Nb߳*/9̕9sW'g+Y_{֫Wj'f.:X;W]ѹp[P9ܜיc d1M҄3L0&9=7~če'8HOBrYl&l=Ds8,Qφ?@%b8&I!l4D7$ȃo4{l&i1ejˤ'ͻb37NҪnuw/֛R[&w=Ar'vL]2>:vTO^QW![+4q R6*A~@ք'oȆޡ3ZtZɨյfF#p,T:"Q}$;T Ilrgs iM =DGWQLGP1"$]=+ 8_G G׶~OU"FĄ hQ,PjRnݠtTae]g w+=\@LnK}_ R;#'N7gt Ȃ2m=i;nwk# kاŢk4 .C1A$5cb<&ńY:,h/eTb"Ƙ)N2I4L}ʋѫѼ+xp+a%GŒikݜzc\sfK=eJ  z}驻~sՖ4}yYY?}LyaZ1]ԵXVt+" FC gY+Qq(|aYfL,-\Y16Mf}b_U?Fτ$wݯQ'Tdvtuz+7lpVkTJP" Ɗ ^jJ.dǢ}Y/̛y> (,Lt3hP8q)-B48SWƂ<}Hec ˂l *䍎rιu7XoG.ӯ* XlSc&6Նx;99NKSNPELMNLNvOvzhh`CKWWAPb ӫP2kea͡:5cvN&IɃ?_1]|xDucq$9 <Sȉۭxz ^&"22=i`r=d%$QU48dqTHףM%RTI*]s+4/TXᗄ(4| Ϋ~YX܂-l H;5G- 4Nt­ip|Ǽ `gzbql&A#"#m LI1:=c-ϪJj*QO?oȏο|Bz#yOO=9`Zm"EK?/ Lb <ٿrvq_me-XrQ bk5 PE nqH&Q+\^%U]Ơ2[&IϗÏ#w!+F JͩHMkL5~j1lz" deAqLxLd)GAl/WQGzn0cQ^؞1,2)x 7;\'hvZ;M\d)/qH&8'cxD6:HeV$-1k.t$Oej̲5]dke77L_9{jyn{y۹OdUl8cӼYGW-;>}tgWl+POxT]8[[E.j Z]GY~^_'zOlunm\)IudƏu<Ԝ;zA^}AoЯsnk-Ԑ+ &CkAm m~kU#dppBVٜjZ5Qe="/lJ%:}*ltFnLd-JC8GCE-mG*a_?<_zC#m}WqYM]>r*L#߹OxfKke=EF-t9#ߔyeyUCit&> "Z%;QתAZ MZ:gZ F5ql>JNcξz\U8#L9mlz ܥ~qGCtpNe"vc쑗zdQ2b,A=.]]&#T~awrd"/5CVb`b02Fׂqꪍ-LkvߥMn1gR_ႍS[ ȲYļUJneFgU` (@B8 =A Nq2p:O?z-*:{.FA=/b^vlmLIJА4T$MtIpFְHժP ^ iBn4й Ojib.e2ѽDZJgg93Ƙ}0{Ѓڱ@iGYڇCcR>$'GЦTܐv\J}h7MKCϓ 2>42> Gɇv7 B3>@>⛠\i\.*g^c#Yj<Me;JJ/pE+^Ϲ3rHO۟`ge?k% }wJtexHJig=]FhVpD0x)sH~/ PPP(OvyyRX99 j{V}~ھ K)4 P0`I>mM^^ťBxa!O? 7H߂{{u:\pu:\/$mRw%̡ws|ڹιN;/|{ǮsJy 2x~S)M-LD7{yoK, ]̼Y/pǿ` A70?5:3KH@Ȃ,CP~!)&,ƏG(1g y,O!Ad&&ARrVja^H;Mƕ(o3_q5[+:%{?y'>)&a8tp2._%K /%\⿄+$Kp%b8vqȴh %Ӣxc2ΣĬxU2#K+#-?m.2 4W eci~N!32Nn&8+dx?_i OUoҨz2Niex +gr2<Mi} f(㴜WjURK;*vT~~FqB@G\ 5L5p ķ92p9 CkS3n6:JxZ ͨbfWAz Pvr;6x#/5\ж.6D>ֆ%Pjz@=F\;A,M6ѱKxBy)%(!SbtAj#>@=\i&ʝ6*qf:)X[bk!f [Vk YN(KX4i3Z!Z ?Vz\u,E:b5_8v"=2?3cCd[`0I聼[d;=m,ePne}S$i KicFGh< .8twA[V3*%z[X{ױxb#xăuM:tQ655|1ݰճZzQ.Y~^^(X ֱ4R֎hu\L0 5E<)mccj=ё> K.5L/ Z5n PJ$Zֱq =/bcɗR*ޒkJr(Q%T5mm7МT-*gFJ6knlccxܷԿZ6W0*\V}g0Ik#!ivJg 9,%ձf֫K rrDrh yhCMJSFU WҰ4COQif6sl/FoٲT~==W= *xHPt>,AEkGwc90 \+޴~Y<XZ~s2}qd}6){U\!*_{57[dObPR$<綝eYn>J/^9b`W7fl+z7VqY$&VL,w$蕥wEeZ18xQ^6eT([]AQXYՈK 4Zꑚ-/ҔVh+4Q,_SP)KZ@SH[\Ndch*K*#䉕ڼͲ=u{PbyyyI1.,+_,[..˫ִZ,i5yXJ rm1.B ʼ \]V\Y v.kVutXZ2o)ז,_T+(BX5*fUaE% hȹ/+-c^h%ԞZMu`31Rz[[Q ʪJK [/O6a(W# 4TMڦHSRߢXJs0}!s\` ²2c ZVtb*+˧)*^Z\)(΋+.Oƣ+ʔQ6 Emf^Ri4+4%g95eyIS& 4XĊZYDϢ}>V;|}_o1%}"K~ϟ+~//t_0!~5~Eo7̈́[$Y@]Z! imް:M8o~К_q?tw'菼?Y @-C<X[tTAf/?/ Y5EЋS* ZT-!k5KIl&_KfU╄G~1//&o_ GM \yQzw,ğ)W*2L,*;kٹj켎7ҟfvba˖.[ŲdvΉlVB Iq?+Zүc|/$dՃ %0 %@Gp #$E2DQ$&xkXR8TÂZ"zb#-dLvd/9D.r\#7/ D.%p+}awG-NOg+ *@5\:U5ST-P媊T媕7TzMբڠڬڡڭګ::_ 3"\lL8,SZ.k#\/#\qK,⑫YZJUՑ U_V&:)ճsհ-{OT_zUQR*YfU몝ڰ&Zk5}WdO 5)5/׬մtԜ:y}^Oy=^Ͼ~vpmtڜRڃk2d~+Kv,+^}o߭ ԥ-;Vw.uE]nnWO8}+`vaa1gm,0['&hfgҚlmC+^QK;25ǚZ:nIM`K%ђk\ܵX㬳Zku\֯qRjRBÃP)@.%_YSKξFkV760gmڱkgU-\Jyٵ7[Z[r_wuذV.Q^\D.M.7;r.l.6T)/K\[VtL| ηTQ^ ޹> >- =h0 G ;|c \}7m Äg4QHmz Z/w_Pp8X`miEaAAAoG}Aǂ 2H!}hCBC½ O{5(oBO>qXN}}G[7 ~,%xc;;؍ aY6v+7|lxfxa#H19b$B±e1mma1@\/p]Ŵo8L^9h<p=җC#'Gj#EbW#wEy{רQ]l*ZuqQ^ v2zP9zרĨUѽ GҶ|K<$oa rnKg;w_Psn^݈&;^]/wӯcQ 7.g0Y$< ST90p4k h 0V~)ZY@"$/ _;@th` CGH6JyhQCvhڡQ"4JF?H f}~U-{z )(L!*~_@/  ϓh-h+yelm62~@.u66~M˦_eo{l56|O|!9 WD]4LMp@ d\/ %R%xg:xg:xT}8֜~!N3Gks9Ҝ~gN2_fIE`vX5 ͭ ͭ ͭ =w"^<o a4삆]а vA.h a4lаvCn<AzE<>uSCnh@~ݐwCnHO-PlOsEVY]b"`Ulg%Y@6~{À`3jEEҰү]yzg?9vw*rK;59})p> {p=[2,~Y.wǪ,Vg>wn'/ 8ڀgIZUZ`mۀV=hՃV=вQ3;xH xyEꏛCz:qNlO½;<8&S[l~|z8C{@L!~" )Xv-]1s<47domgc0A̴[Oo!^;8e͞Ck=_WUCUQ`  Up_q=GgȞyoXC !O ?'#w'#G'F k74мI`p@F))ҲgQ^G✧0)s S{ -N):E)lě ߙZa7 1yͰp9&dlW~"o!n9 D$?Y qaynG:bPA9%}ߞ%={˳<%³K3?sr\΁9p9>.09 aكS:pѹ7:'!&wfi8%sp̙+DIu<{AG1c<8>r0ΝY Eܻ^*pcF ep 8r3CӐ!uA6ds@6ds@6r@.r@.r@Ӑ4 <,e ,7)v5 (9k5Dž g ugQ΃Q^>}|.\_z?ʛd? INA<欂6fhs@ Q7aehW I>uV 7G1wXTg9p.xFw(w`IlXW%62Ne: tECcxҁ9 w`hUdS?$x(ۦu2)rP._^A|@"_rXv+j+w?#e4ȫr4˝3)]{f; hc֧:kXt(=E|e^T}YU|:zYA|9TOUUʝ;p5%GRKDCчfmϻ Af脙%ӻe2N2g">S'A[0=`U|2FMCdȖDmQԗ'T֒Fe-]`kIuQYGH{q!ӵõn1IOfQEd32& r\c0gcfv/hF}:hp노~ P`) XV"[YV Q9@y,$̅JqR$1 @Z_r8\y@>Ph(Hr@HIW$-PT"{C!UA*ǹz2fuh7;<#J@`V/bYku(`A% ay?zg<8>U1RjU ;OJ`p)3,8 GsS?T0%km| +g(}t. pFf%WݫC;g]Fl31[s3D]w/{esŢ d3e9~4/8XәV.*dC_ccz:fGȨ$6ݶFk&: Kwgg+Nϝk̬5;5F!z=ሞvϮ{,v={oq]^Wuyfg}e쭔ƈߓ}sk s`9w>׏\Loo}{3vol .{ț[ț yg oO֪dͅ%f*3V'7xB^@8o#CG#WOC1 /yL#~d:#H^$9X&d78"ȿd %88%q 'p<ϏG9|E2h>5?dOOd)"3>/“_—#_W~4u|z^Oz "H d0^O~#<) ^tYL [#'XXY 'r\8,pt ǐ 8Ep\.WeIn? 7p3p:mh b0kE$K0D^2  Lӕ^ @ %uPd%hAl}Mx;/}r {r{[E u'@-`l@3Af}qe،J `*(ҮةoT7h=u _OvE]F̦;tW:alڱ:5G ]84151_0&6]`5WMWƦ^C!$k |:{Aߣ$/Br( ]ওƅcR| )|KwE c5;]{+RK*Ctu)/M5biFi%m,aR%4K 3MԖɍ4p!44^l܈^ɦR%qqRE+@ߐʍug˂ˍR0R0ښY46lHI.j,;i 8J,λuS%=4]Mg,uhnmgKniK3a+'$LM|i0aZ hB-u]trZJh9WнtRx-0 i/ԷIjR )8oj.mB{n mkΔ>z%R(ݰ\ԵHa0zxFz}LcƯHE"H+N[n4n;M]MgN;|XLCRPCitڇBR5^f;if;cF@}(.6wYzQ[;Awد[hj^pD/@0}0CA$5<J[S']C>t {e~}EOi].>RkOI_Ys3ӭd{^:͞-(z5j 1дoUYJWR]д`/g[kMwoW`#R0}$k\5:lM4͔4nfa~z=DzY`"YzH@w[V^3փM8%2z% }b8L^bݬmZ{+$q4#XK#n@cӐj*$e52_lV賠/kݚ3__eZ #ż["lz6OV'qW߀5n꿒.ZoBf|z־Ѳ@!7GPF_`vb$߸:tJ1CdQ]}+6 {{M1ͷlw,Ml/F[kb|k'm;zYŒ 4 Eֆb]Yf`c;൑hݙ1m` zZdZS^ 2CBcm1mO[6aNDn̈]45S166X4"CmX cдb"AdnHh괉d)[zS"C6VC-'&7VkOGBv[FAko74V;hM46M5`+f m3 .=hh?7#'ihhhXFDe^ XUm2 GoY ']+qe?OienX=[~k8oz6fL׶y3ͼm~f5e*t%mؒӰt%atKa6ٖ mNӵ {L7ZjjynmpN[1 zzmi8[.ޠ6i:p>`:~=OhYS?̞K,Z##ZYb꣐ǶllV?R݀TT"\9~ ƊnM@lHjk;Y?i%ĤmMO$#4_QPڲ N^NGuS!{td5n͖LsZ:dZX#%7ӓ6_Ohk-/l9k+[4kZN*^HӴMa8!e&4b34XREIhOf  1lUQV"şpC051Ƹc۸q9qu=8{^ݝޜ잜{~w~> lghI N_>84{i:{CZ`|뢣Ä\ۍhP#nRTX~v+,!CCJkhdׁ=iJiMb}*]$)hl?(kbč }A,CUY egA98tPὟ:{D$c^x vp8Y0Su6t׃sC}LJ*TE\Ov&ܨ 奈>:PBK|Nc%2,0 N+;j`; _w7c3t3<|kwC/>nh{!?3Vi_AαH?4=cd~l{8K3~A Of\Xvd`.Y/ڒ+ғ<|Xzg k}FEzC]%cѓ%"]ty0vrxcЌk Ɨ,Kev|flHwtHYO saѰ[pb*"}mO}e﹀wwM`X7#}gmHex`8`۸K}Ɠ4NPd. \_ U Osdzkjyma=Np(!kv(uAxeEo { ޳ yO5O?Kw WӞ#] hhptt~x28hp:s`Ǩ_oy _/BۄѶGu${/;7aHcg#E{S'Xxw!ް~ =FU*h".ZEp+Ǖ*v*]ծ:䲻Z].Wp]ӮYAć]G]'Nzuŵ亁puܵ)w&v\ۙљՙ۹BQs2 H(qvwwnΖζΎnN7w 6ƒqcvYB,0y6WE:,oB ;;(d1-AvU.o'rA"di=##"ʣ4i4 )#= 6f)}R.0l9fb y1YO*-(m9M}N-+Qޜrp^jVӗnc^j9X5w-^Mw #$V6-^T6~G?vU.. Qzm> |"H_GkcXOG Z˪\;k">92>ەg\qߡQ߫TEu6 Ey h?;:#eI.9&S,iQ{Uc 0|>V@`:,0;ɂvb ߋN'raQ-ס. liϫqMxQ`i 'pc _!qRuUYi~3ǃS<`BH;O/K `U /uVV̹*T>w"~l?h tppy,= $w^\H KsO`]PqNp(fNvx{E)QnCpV_@YP2x$P< gM {r5h^to/\a)Z?8޾&{[Es>Plj:'5ۢ/J@WOz>vG IO\[#zPy??[߆=ݏ~,vMN]+Ğ}QٗĞس{vl #f!t``m@Jlo;ݸv}> ڤ}>g/؏Oz8odjfp~]פwSMy7wWc/^PF\Y\z{!Lu811F@($?F;";.yyMAR"Oʓh,9*KX-Keeab,S4KrYX2E8zerw,w-,-,ٖl+&X< ,E ]@n8{2=h^.!\F NDϓ2EF;!L5- Y *,j+DvԴʳՅpA8 ?%~HH% {<"|Y^PG>O6`RLVCJ2وL^!kԯSfb ;fV|"t#&"d§LoodqH5muJnu=n{{=wOg݇>>v\s{}qw]'ٓYYhy<+z2<%r18D|a<85ZQoǫp^H;=%( >hzW +uA92Ch 0^s_/׷/}a>\Q^T'됟kz_׍G|(z/OXV;zpƛ91{Zxk<ʽw=m<~^M%.FFbs3,@Oqx'[ܛ[>Y۰kY Oo&7?o@C5 +{+z[{yZzwY;;hϱރÐ |i!ha}/xK}o+):<ݖBm.%}<R29ޑЋzJ=OV_hU}iC7ɛy1`d,5z]bffuВV!ޢgl7\#HmX4'4\Gp.8͜n.6C14o8nG`ӅP| y +1h% BI#B"wuElF|BJZ!6͑-B#9vGbA&ݢIG5y* /C$Vm2[I&lZl,֎XێxR9nw";紶|_(3 LcI@Jli@fnBlg.ձ< 3HuFǀ3XDlЊnGW; t:|gPiGxAj%rjn4ElF!+Oq"Zg<^48^+ Ϲ*T># _vo†v 01siDC6ǃp{E9GʝWYpX1 }>}hjoj=/Q;c_wVܕ?~V?,֮V}ќR+z؁Xp&Dt9תjY/q.gX{X>`0#xJ@H^PO@P@#`v;QHr7닁  '  W K"\ф{-HsÕ-kݒ+<ևs/%e%,,۞9llIQ:iKiMptێZl_}m~^ucvʖךmN;&3mE'Ŏn[♦|[UːcvܖݚX/E<{QQVzzmۢZclT#ri%h*>Evq>'uaf[mkcvVZXhj1llbInl9|ض"r&ccdVv[fw'} 1$BKK$5d6*F^6&jy bM B{{ՏG O'Ywt$H:]cDhk-1T2)Bd^Fu#lRW|Zd3Y^K٭!օႭq}Yv'luckb S̊1IL8F4d^C =80V!lغ!?=Z:zŴf`/-B%]* I|Ђ$CH,L-+`EwӢ%arvl6/4l>Vؖ&s'~v-7o*H+.H4 lybb_pո|Xoнiӳ-MFkq1aS5$֚qw\kJ-WSWitXoJ115ٺw ~c@Aޔn\b+bēEfcQIc)'Nfqcdlʯ-bb/5[Qhm!|k574L "mT0cn{ʆycڞgYgvy@|ZM;Luűi0(6%74hPhD^y$ i3Zf<`n.5>hpwwSb2>'?MY/o;woe n4*׌9x`Cdsqaxx|ĸT|Rg>`)-uśon>ZM6=6l>Si`3CvX775jU[amzf6d5Dl$2E }\[{xjKПe

    i\Tw[M)\df߂#ƒR97_ >G^Uó~BxO %_Y ^mqJ*IPx>)XM!f9HG!ןs!\!܎J.P1#~]I1AdZv_KqC3 #9z!V2C[G@10 ͜S?_Z!Ok #hPUmj`噝[} [3ZB4ACћODRPCgdݒVrGJphNBLwpV.Sp%pgbGY*hL?-𲰈daX 򪰈aR}a+Z$MbZR'5t,t Цnr@}l5@_/GwWPzzP꽚KثQC%O jJutg =/PSƮtF<>}Nї醐s9u5ul]7c݊)IkvRǺ}r9Ƚ]w ]ҍ,kBƠ"@xYBnJxWuחK+Vt'ug4ꐏ1gҙI>T<=ZDg % -z,<(ݗK:eM/tI)a.eeH%xG5qi 6H>Pڅ#wirr{&c]^5v'ȥAS澴Ax0Yrr+i ˙R3  xZ'k!MISÌ-"wJ$^#{ ]la]m?X-UA6FWԔZ\ 7i.y5Rfb~ 7E(ٗKbvH?r咘2%Pc;!ޘ` 0@kf-6*4paW]MYx"!u]X3+]yal-hx!VIecv\ڃma=)L5-KC)ZJj$Y*&ѾK`,<3.u.36 pS?u˚2vj'sd^ wǖKusG7)M|A (ڡ)4h"ᭆ˥cREyLkˉOlcdDr?zWf}E}杞'&[ ue׾N޼XU~͋W+_9]q+HwT|ߗ|s U;Mr c#B!$M6o͚"F4EHy*)"""R"MRj)"H)PH1")}|b}y*?̙3g̜{ratJU+ʮtW>XЫO]jEȫcշV;uYW{VVDg/'"4ۮnsunub-l˧١#zuVt\ŦMD)C;Gj'WEzTEtq"䝶w\yF+;>;zR(t߿J\,!iܛd49lkSZbatT'uuԪlwEY.wO乂*Z/mV'Yȷ̬,[>T6iN"?RٷrlkuTWfa*]YS>9>gtw[L824ߺn̈̎̋,U"_٬q-UK荈ϼO%*_qWԿ*8\W?u +ګWjҫCa5~:WGYyqw^}Hf?3J>,ٷ7'-Fe7ҒW] e(%/퉹͞5=k'i-NiaoԷ77ap5E뮔sva?Q0ڲJ%%b$+E]G'unaMy].lԲe6e(,UlGY|Qy_+Sڋյ W'?f+ƼViȘ҂/Wfz|:; #m+-yT3TgAyu-5meiMEjIPriêGgM+CˬʴҪȨhchʊ+kT*KZ^9ӥ+RU+Ӣ*T*d\]W27:jOcU#K7V/Tz"7GWWNVu"64jGtiKjk~?3W6U.mԜOi#kٮ-hiN F;R) |6ʪ6{'GwiNtrUfto{?"]g>g֐D<SpMqR FHJ8XvR *C0 -9uT$w$/sQp,|""RS.N.ֺ^GRQ+7E"k J母D rcƹXk?,F}o/L3jRK+]\RR[LɁgJשtQ~zFNPoIY]tw01o^!R+E%ƔJ\-=[rDzVRrNGyJSkSRVH)yJh<ۙK$v\|K>Yb+P|YZRqzzR͢_X \[R6v*=Su͔9Ĭg?!+|\jDei䲌HjYf$,+ҩ,7ҥ,).*T Pd ec"EF-/X6=2lVdY6W.A+N+/:Dn~Ӝ~mHNYHv .=gm4;J#AJ9bSbIJْcuի陔mi3~Hz2WMPMP䓡Y>'%Z 2CBKz(o(-70Tj=z|zf+I/:Ԡ?--&uKФg[{6wU[B!04354=48{@kgs%n,R]][ n9pjQyǔd5{ 'j~A0hRPܕw< XPw`cpupuɂ=fɧǖ[r ԟڊ֥4U>rVGAEQjQzQNV=SnV9 "wDLiUd$CbC'ç'`HXhkަY\>>E¥||،L:US2d^,͟W^dJ/Y[dCоjUVxGޒ%JԖO^>Jnfm%+JV*m+|]|=kȟS2OJ]AdIm'.ԶKğ3\5YYX;*Fqև7w2߇ǔ܉p,_>EٯxsNےtkkA9 +O*v=S>Qܮ%jmp4'ܯhIx@pqQ,\ ..<Z4+< G *,E? u=圎b%+y+T(^gwki2U8ue[nvMޚrkjz<̞UA/{`xG ɹSˁ.rs+s›*cHtuY)zD9úYЪ.' FxOx~f. ZKBy~%+wWrH'?{|x]\YguJ|:|u2CqG✊s;/3 9s ˙33籜tE?98癜gsT8CT9|c,gKvsF) ѥ4rN؜99rUr휙s<Ü399sR&}S]ndS_(Kx@2̳=LpKב 50NekoƠ G_k '])N?WipUًdS#ЏB/T2"H:[OǓTL2;K A* #3쎆G4X,hΗv8MZBS8MJe``{[]E)ّ'$ת X/'`jL?+2*Wَ|(usv_mSLΘI"Pt.|{ony= :BEngE>Qh=({~o}6G=fLоD~dB?`WKA7o z&#SjBQ`L^=܃f'Zy,Z: :ivbͯJqOyS0ޞz32(>g \aLhsuB&h8G!L> e9sMdBOѳNGE[j'̌,%y*R60ZNHѴU+uYk}љ-1 |MҴ[bGaӵq@g<]oy93ρ2+]ϓ ߅3Zf>JjDLzz, irsLsg%]kqFW55pG8'k=g?{Њd<ݠB_m[i1\mwި9^pvl˜(9QxAop XZS/GԵ 03kiMWqޝb7(:y%}-Y *,O7- $+:?'Kt3oz8qZ7Mgj=H쎜N>dGr؁^7J(7.u >(PT ̷:*Lx D)3iJv2 oŶn!?Yy{)3eM`T'@/tػ NF}*x|KGhƌ͸jB$ނ)A <5-pNpeDu`hCU%9g@m|ɁӖ܋\>muUoZ+\@ 11Ӎ!&C:hQ3=АF?2%m~RK:`"c;e+u""eMAZ&D-Z~lEVUk'ӫ+8鑷&Yk 8}RI>lHcggw,ԭ[Pg,:.F0ZD%䯃flt;"{\^W1aOmri@떀둃 &F@}7Y&Ȟ$`VcF0;U3a{*J]p hcuSe"}b䭴 92s䤊K-l9~Gv)?\T{UFa~d얣͢oQi^n gY p$S0g7AMZ/7 oN['V2E*vԂC'{nJAG kY* ;𻮸ĊͺCn=\ z`&yЍpנ,74/RƉoa1"?zZچB;|~bt6 Ik UphWKiLtͺ±khxܕI9pFuJe3wWs-2`%\~ =g䮌Zd࿄7t/h=`8hZIRj$Ȉ= #JuRZ7r{ۗ9]:  75Er@jAA矒.Sҳ#&z@͎h(ݎЙGGğ !LJ#`;HDpM$S3 %cslQv ߧo#k4? ?8F}b$'hmGS*]O]Tb @0J]/ D@7cc'5 clD=fM9:&vk;Kh̬_(E.!D.tD"jtAHձ$":G |Iy`PbW2A t N4$"=VT. :yS삾~* L=z>$ι+'&N`:59&s>w)jS"|Gw_$6xП=zDxx gU>rڨD4pHHFgȷO]{6t[W#6ޏZOž xA-,=Q@ބ cFr*LG߇uxRзAB<.9x43 pȌn#p&I`!hwWѓv fwGۂA0\ZdnFsO@_z'|m#M~b9_'j͡W:ol^Ūj¶t?Rvgj} 2GhcbTȨ.3+௠G &-N", 6XR$_мWjH l,xӓ<鱃21Z^"J| :Ͼ:&`:n˜<8k97.[0Es'w xkWπC8Q\U4Ɠ*1"dH#2Ę1D l{M%Г(e=Kl1m@_$dt׃A{S!pqZq3ZLbcn/pXCYvu&"Y:3:VWGf~8o/6X>Խje1CaXpB_D:||zC9~4~BQLJ8e.Y ;kn פrDjN:p3vfZw-~3Ѻ 4\2 =Uu/W_A3YL5zC ՞DZl)y_RjN#{ߢ-Xe ?nU fA 7~2C㯡SG3eZ )K?[@zb0ޓLE޷lη43`ř}d]īzl" ;8ژ@z6(͘ }`h1:(yh Alji";,Y VIC:Zqqb)Of+A Ra RI.~ <| ~-e@{D2zUt&W"Fk&ji|<@1t/W4C^8 V7=581'`AS-)8O0n|Ar! $&0EL[ cY+^0&M"y 27Dim@x Hd:~>mz;v=plyro d"B7,eomf>}m_ ꈁƟE6:Af>IiGACn3l}fZ:ٿY렵73լ)6+όv> 8~"r3vZ\@uS6h}=|?`\~&DN8=<_@sdz't}cn633ꔰV}jרl13`1ۙ,3,6#fs9|\b05ט-sy-}AzCۧmm??[ih'cXƤ2t-L/t~H=fgߝ?姻t_kIgS>=^Ncɂ䂬h ҵjm:+-]8pFU[ )J-)+Kub[W+X^f$Mn5Mi暦6tosM5tٚf)!4;O}EӚ-z٢}٢}٢=lќfihnE6[VTgG+CErr v{]zeo;o{mmvz?{x{׽>Mow;{xxGwc{^ww kO2 oyoSo{[==qEgj*" &l1'DDEE3"bv 0bH0+*""5"fĜQ1W]ߩ3}w{C{zz篪m,mgl2nբn~Q{OCsdN sfUY5V`5 \sg<'üX]kXkֆ[֐5a-/ aR֒e>gY֑ :l%kƺl~bXo֓}lưql 2L;L(=J"qz' EOғd$=MOhz%yz2^Xz^!5z7M2ަDz%{iiB& m .;Cۖ8AtQX) !y1y 'O4#o4' /+ĮHEZ-BԚPҚ2 jJM!vͩ9Į%+Pkj W@m-nZb׎AS{]D v3n5Z bB] vgYKݥt)rbw%] H!vi2jbw-] H7Bn!v-6t;.q.t7n͂ͦ~݃ !zb={͡94b={=GA<|{^ؽJB^!vo[wZ@&>iiJʐw20ً,>9q.y _ĊhSg ʝ.U>}~e/o{ް{GWNY%f/;UdgQk"{Ujru"הkɮW ogHH!ȸȸfXG}E,WX 9)#xpڌn"ceXYfŬY9f3[ 7Mr3${ueoN-e_Fn+d\_n ~Q$uBWP o((z _'!J#@, y@[ `UHWH%"31f0*95nRT l5-`;iiϚdf̘3g0Zԣ%|ěc# ?& 2 +"xMeO/˲)|SlMΒ@ȶr0` # %)0P,{PNBd %2rP \Jy *SGJe2t5fP̡X@=2z\6 C>.WbD6l| mȾ $>UGP4ZPUIeF¡ $#I2L&!ʧ•\aͰu4͕ W>i-ٻ w[dvv#{w@ vW-'er,,,-nj!3G 3mX3s0s2!'"<< yx21? OM~D <x&2,d8hldغVLi!.G]LvF@"2m__Y\ ĩ-ľaѿcx?:\¦iLc?s1 ?4CPi|X,0. IWt2GhU&kz1_Ͽ>v0)"%|ٸ!|{ \)|KK?G4nA*)kPxows_Т5g "\23 W`O}5[O3G:'\nO xϕ(d cFqu|Y&B{.y F5>3v!q+_w*x9~>m7*%ޛ)/EꀆB?>IAmy'x{K}d? \,σ_ 'K Ӡ3S]T$ҡ?ywJs"ʡђ P+_uF׎IZӍ*Y $W_6 F_~jaH+փv-nfk{ #|Ҧ`<`ύ ٰ5;øud~G_m34-Ù]EF- &ю%qdIZ^C6|H69Dr@8Z !{ȡԋ6͡@+F{P:Ft".IRRٸ\-o.ع|u$a*)ۋWE "^Sb]7kp)|Ha9 > ډy{84_#K pxdۅ"\,-HZjXs2$8\ZvJvi6Q | 6YJ"\Hk' :}8}XYAȟ+mZ ^@ 훃5V/- ad\SJhc d{U!7[U=ĭj[K/>t"UD @#H YBDE,Bd YbD%,Ad I@$,U!YrH"I*$dDUH ")ՈFd YD֨Ed Y:D֩Gd ـD6lDd ل&D6͈lFd IE$T-lQ![يV mlS!i!B#*$tDUDv CDd'";U.Dv!Kd H ٍnDvLD2T!{كH"Y*d/"{٫BF$[Cd"T!D!rHF0"UD rDE("GU1D!rLG8"UH"9䨐@ E$\rӈV!g9rU!99rW!y!B. r *$|DUED."rQ\B"TeD.#rY\A "WTUD"rU\C"TuD#r]@"7TMDn"rSB"TmDn#r[A"wT]D"rW RH =DG yDBD )T!yCcU!nhKmc[T68rC і j 5j 5j 5j 5j 5j 5j 5j 5j 5j 5j 5\ e*ՆjCR d"+TJDV"RBd"TH""$T5Ij$T5Ij$T5Ij$T5Ij$T5Ij$T5Ij$T5Ij$T5Ij$T5Ij$T5Ij$T5Ij$T5Ij$T5Ij$T5Ijc2VbX2VbX2VbX2VbX2VbX2VbX2VbX2VbX޳>)GЖ"战#bB,DR!nhKDd ,Df8DS!؛7%zS2dMɪޔ'#qNjqNjb/9{ɝp'W8o͓3}g9s/@QAZ 8 wM(B4x?a!D )BY'kӠ #!JSN"jD&Z6$E/\ K hq#N ebNLLqxDωbH|&?hiL5e5{EX?<.@oT.FmBi b X֪*` kѮC5,l@&Ѧ݂v+mhnGvڝhw@m&=hEvCh=(chA{m.hϠ=h^@"Kh/*kh&[ho.Gm!ڇ܊5wphXֵu-(ֵu-a]K F -ָJ&Ɩ +u [-A– aK%H ?qWOWOWOWOWOWOWOw,Vv&YhbD2^B>5h0UСmG퀾†5ԵE԰W~QRbTP6|LuJLI֌I15WCV(TjITCc TtR\y@LѰ|۴zڋW<~reĖ\mf_]V;r 5^)>9vg%;(Uy딌M:WfrvCm0&bW];{$c}mz!{z#-0j3_olD o*<ܔZ8v.Á$7:̡ŨãE,S:u(<=eF4C߾eo+wti*[ܴl[2\ YTŠ> &T]#CMt[sM‹*ʗع~pz';NJpv.G~k N={؎LϛD۷.-qɤwyVv j^?i:Lܿ Mm~21yRGbm*~{$nc̩WUlv!_krf3\<+Jj ,4h/J(ejSΞbmӧyKTr/kǛg-6mn 핉{h6JkURˤ<%QːC_S|B{4OR!\k%3}o>޹e3:ݣGfj s3˦ U8*p mJ46uؗ=mD˴9 ^qg8…/?8;E~|إfoM "m;3E-LnbNOlf0ˡYI<ڎhR+Jy!w΋˙0kѺz>Kτ(gJޱa={ؕm~ ԅiknޑxT ~Ts."G\Iϧ:^žeyKÆϐSd35JW>^̽͐V?C*THц0zocN5n52IJT3fec<4!xЀ8*'eOm]ų' /o(yL!lv`?ݯ])lpEhnvOx4|>P[kYv5.~yB@/~!ܬYn v([Ǻ.rkM}wl3bvuJ*- kp߼ݞvMZ@|չs\q&|q;ιz챹]?.u sǟ֛]C>]Z/w0sk`} =:kG۶lbS2W}'E=7պ1v|xhu*qM:/[9}S~˴vCD}7gܸnZlXۣ}k*ב/}>dǬku{d~7|ц5 [w+ ºo$lߎO [=qnOxߺn\]&zN}+_EQ0HWݚ;nXUosf4*bJokUùTVSeɾšn$$fyg75/洦߯l]i'V=u46ljɩ 4G ~͙\ͧUmWũin#'&Mir&))Z_߈ \X,,9%a6 tNɋ~.9Q찻RnXfPzoX?QJ_q|^`z*[kV<+inCG_z({֊w>x> @m~!}˕M1^ftsL2qMR 6Y߬7X+Ji9 .Rk 3ƅ4iaVYx`˃ә+Uq>-T˴FAjBWs==O~Y(m5y)$^v=vޫ1K=5[ \oߏ}4U=w[77UIߴӿEB'uGnffۍO4A_DESÖy)Tn9es[Lis@D5^Bcu ^fk6NZ'|eڛDs;^V :5^Ūhʏ b7`xg SSJ_ ~n.5O.zP\~G `oswCڣ^{SsƲ Ϻ*7\\C:t9ze~y?*"tcβ7nCM,L.((5pd`"g ÐʐΐȐPddHfJ\ SVj[:AH%J >L4iZJ St~.o SW.y;y鱩-jBoL$-Ʃ;†ُ4g?^zelG/SNVT)]6i5&7C]d6WZZyQ3=ir?S]t w?󭟩1}/-'k$}8{.zOKc\]tۢFRc9cSdgF^%Xٖ1ji5 qaLhZ%M6vRxv bGic+gȶT^d_bwIxOݽT7ӿ-vB/ AK]L]Zh~U/+7|cv^VHye>RU?oY|/Mh{qnpFU6^qfI <\8]rY'y6l0hbYh8u+.]B\ɂ#9 y'b@ eE Y Eۻ?u`׺-g^k0 dV/8ch.' B ҁ@VCB9; ?( RnfibdHhX#͝W|ރ;;>z_24NcQO4Nuϛ#6-ᨌ~'pP[f#W4HLkX8|w7j3}˛s-H{˜x92caNƭ|_4yZU[oetf[;8ɾ=:WQKVs+~{U0&Una`  endstream endobj 91 0 obj [ 0[ 750] 3[ 278] 11[ 333 333] 15[ 278 333 278] 20[ 556 556 556] 24[ 556] 26[ 556 556 556 278] 35[ 1015] 38[ 722] 40[ 667] 42[ 778] 48[ 833] 56[ 722 667] 68[ 556 556 500 556 556 278] 76[ 222] 79[ 222 833 556 556 556] 85[ 333 500 278 556 500] 105[ 556] 111[ 500] 177[ 556] ] endobj 92 0 obj [ 278 0 0 0 0 0 0 0 333 333 0 0 278 333 278 0 0 556 556 556 0 556 0 556 556 556 278 0 0 0 0 0 1015 0 0 722 0 667 0 778 0 0 0 0 0 833 0 0 0 0 0 0 0 722 667 0 0 0 0 0 0 0 0 0 0 556 556 500 556 556 278 0 0 222 0 0 222 833 556 556 556 0 333 500 278 556 500 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 556 0 0 0 0 0 500] endobj 93 0 obj [ 278 0 0 0 0 0 0 0 0 0 0 0 0 333 0 0 0 0 0 0 0 0 0 0 0 0 333 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 667 611 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 556 333 0 0 0 0 556 278 0 611 611 611 0 0 0 0 0 0 0 0 556] endobj 94 0 obj [ 226 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 488 0 0 0 0 0 0 0 874 0 0 0 0 0 473 0 0 0 0 0 0 0 0 0 0 0 0 0 494 0 418 537 503 0 0 0 246 255 0 0 0 537 538 0 0 355 0 347 0 0 0 459] endobj 95 0 obj <> stream x `SU}/֤[&iҦI{i ;6҂H -QbQPqA% EQQquQq4߹拉0934={} 2h>{x3ewU׶{XܕIukO>9  5ݟ w( S&O_:Yo,, bΗ#}ޢ%ߟ1d̊;~n_`T0m;:nADz%`?+s{8on?KѠ؆O^WMgb]Kp? Vpy+i6%-Z8;u-xFd`iv,z^~m.Yly kp|Ү%?X09 ;c5g91c$pSܥ~zm&Y5} S ?o&Yji %) VNk!pt?` vJ~L!=@Q L& ݐ'cjvth .0/w L!^f80,E{O|3"k'> 3ExMD㯷֦;| όCj' /-oӾV0P &/ >r*XA~?_,k95jGov~DxJ%B-TArvLfg_=Ώ0}ˇ@{)nUp{?=D%*Q!~l!ޜx:CTDAG) 'jW\X{;UTD%*QJTD%*\~{fTD%*QJTD%*QJTvzQJTD%*QJTD%*QJTD1ȿs>|81ÔҠa:t@ RX'V ˝j*SaFCoCE\ ،dhqajsOic-otWԙlGVIA9*/\Rx(#϶MoC;{U齼qWAp'8,/z\.Y^=]R]puMoc:u$U,4{\l>?[;}f6#smKkH`BM{u[_:ns.YnFq oifTu`T* R~^?ɦ1/8d&#_qItcqsv9_\SdJ >&(tA:uUs{W]J\,ap} T+X-E7[ZSR;ufkP{=!z^Zy]{6\C [PGZ@z_Xi NT5fۂmټօmr6UNm=XWtm⥠q͡ƱVX1Q:<kwbe0o:.uK5Vt(tIF 5AOk}mm4x)wv68"ψPF*`th< ~ơry3SaYXԻwOhq UV=Bic'Yuwubq_`݆ z5ge%soJ /~hZt]%?Zs|UQw\1 !D-f`v#VT1.o6)as֏'2q4 d9 9 Y,A#.d2dR<űThK URő72PUQ{ч,QDu7*zX=2Do'z;E'pb '(C)vGC(%}(%[7T5"|IK9y>#㧄O>"|H>aO(Exr cC$!{-›7k{w+ /v^$@xY34 O$%|BCP >aO({n( aw(v(M:zkW _!LD"Hx{=Gx iS'#jju3ކ V[PoF A݈z# ףn@]zq5UW^z9e^z1EPE}giԧPD}o>(#;QFGg.;QnAϾbp aaȄB2E$#%t sGf$"$Z 3GBG% YLBK47AND@`tEdu# ˨/B}QC} 6ԳDL87iu`UV+GlZ)jWZ'ܴSO 餀͉+'lZЮ`{-={z{Zz:{\ڳ ʍ=[{v؞{.\ͩ=ZCƥedK Yv/eBR6eiR,MϨ%KK5.,ٴ80yū_b,6cJ/Vm\x{B;pH,W_0;' B߂@@צ<@=07;pԦف#}36 Z3_K %0750mdߤ$775&754_}N,uR$euݾ.,﵋Kl{m*+I^|AI 'mNH Q$vuĴ$LM20m0 1Ĭ#NEL8F9m6<`x N61,61~>F<}~^@z_a_Mщu̯d k PBX@dN/LTle z>u).~exZSP5eV ̠bm3g1v~[jZ֥Yց)h7lW5W/< Җ}Բe˖g/Qв?=ye.ٿ cG䴬gNh^&y(/ɿCp!UlB2::KF|?43l;xkv8  ~VeoQNϐ/ kfz>F$?yC*Hja { eaLٻ\yggg>1gṹc|;'Ցٸ}0C;|Ԟ{;X#x,2>)z z t/#b>| EG=2oؾu).^Ǹ;|TOo^G롖 GRq LVIeLi陁pJt)SKXq43 KfV7,9X*KQ4\KgHYT3i=#|3Y>[lcy.`Ŭbh|!+,_b5Lp $<{wm?oؿ]0"LA~-_7?  ߀F D8ap:"(al= ZU~ dO ZL[UyT*yB TGtly,́5 /`TAT(\i>)-**J=4 يKGUE)?dxML؞GwYǣHU$|#SS,UUl[^g(/_MM󔘊KR1 tHON|jnnFmz^!zsd9^M7ܩ5c=f%Zv]x8xyyŒ/tnM/4K&鴖{Y.޻&7I1j Y,GpӝW S6{ТࢿNYxj.-p5Ŗ<ˮ ClMb~;1vS7UɗS:I[̬tl*q2V6npX^[ԲI SzeQdFpsqe$Ee~.)EbVx1N#c2ΤDf?ϕ^EA"+3{'~{W^AUPώS.;ĮҁMa'= 5iV[j{Q㬒46cy2Nҫt+ǥe,n.13nԮ}/?`N=i-yęgL&ٓTo 0Ă@p#aU[X~ig}P5P%@8lXV1.|+%33UKm\~ѭK=Beϝ>:#^I9'ș#sq$90V[8P'3]Fzf ;q4&\MpC!>P2Ocu*Z&ST3$ݏƬNجfLX݉AWŚ>֋+<a\ݪ1vIdXQBСsh_Z۽D~|H#9ۃeH(W-/QaҦ'FQ\mϩSתԱf9)-AK)z :6y AwݾdV9 ʄۆ9w8seи5'!k4}&77/n J:si6F.m~S,ޖp{TyȀX ?ܭ$(N$&Zݞ|F|QVV̵ňhxgsн*{[Ȯ90T:XPf1 nI٨-N Bs#gwxJ[ۮ|F*QP2ܟ~ؿ"lta=$C0ݯ)L**L0oYS ~#<]nG~M!)(ςO1hwyF*3JKi0;^!)E$f.(sZV^[iGl՗qZs娼R^yAAnkM_u姛2I&l[t0N1=3N.SutC,g _W!ғsHmƋpVz_M}mf~]1߈uQqo\V?Ә2m]O֞&Ƥ9,-MftkY}oX|D13v_,K^]9jsfgü >!o Vv0L$`QIdXdN,tx||vVniԺ#V{3LqU&&Bc?j腗|>Ҥ6`T*4NZ֔^UoK=fGݕXskEeRii&U|e̩ O|$L_Mղm%3no+weCn.~Y(Jň; M ښ='rb ߂nj9a܌暒D\7<ōs]sjѿr5W+"vōNp;<5+)T8e+X8Y8jvEc&ϊx~a_bf|5EvVeis̎-6~fSKwժB|=@E 5`ieC;vBt}.q( Coy^p,CpP/o:Pa\1b;Y,v*϶-g;DE}+;(7+:Z~K-3 lړa>NH ldDIvh2Y DjET}y͓~ T6(hkVXB# E`7z׉7I&*bV~wjm?ޤmZx_Z(Nq] ,rI;ql5a$ 1>! Kܠjw3~1h#Rkt@-3)a d.~O/qu[]ez&7NW+I'k*sgk۠S[N,vnCS "io6rv ]PfШMƂܶ[bӸrvwF`YzX< }Q~۬~OaVΉ/F!8p8$.U 7Oܴc&g7ra+"jhy<,8nnxH%$@A~/ځ(4bf+';!?jBbru) l{{OQ>{Rn]TXQH*N?Phhđ&} )3ͭagF~fR(,vWok,HE]_-&7:X(m*Z+R%7ѯ|7 V>@SJzΠ34}c]0ʟ\Jzo\1AOM+AuJUn6&Du g[^ke;4X`F\TT8LJe X)X9v+:c iuYD)@N\DZ{\ v]%!6۹'+" d՞ZyMZv@݊Zs0~möĦx{|}T"ʯB>#s|"- zkvO2q:;d?v>uTOݺx<پ|E4}8cB:qc[O'PZꫜFJjKA-TrjJ& SgufX Vɗ_jJP6-64YQ= 7${B 돹T)yJ$<(pCZp?2ru2.gutQWo/߽5zt~Une7՗umρiO7[mejh/UJVmorh̭cZ];m@ UNvϽ4QsPx$Ev09Ϙ)󎵇bb2"Im7t}oXҠ`*}sW͡ɄUg.PKgl~QuFl m7 FߋM'dgF'efM),uBTw&f{TV$w鰔wiKٷme&XURn_SkRg˃Km[uCmcȅ< qj2K0=`JeN7YVIAc9G5Os9LyjǒzӂjSf-uZ52h(U>X]6}Rߡ"9 qQǟެ^]p/ ٻ/L_YZZiɌ[/S<-z5?JWH"bD.}+zj.lKNmQǻFGEXwYpUmhu[ebB& %rY20_i贉2MT kiZN)t#!?^Qݷ)!W02qch o.YYs2a.&!6A(ZeJvho2ftI7TؖMVO{blzx-FEI?h!A֣[IBsHE*J\2U(v;=ӟC!{lr8:kCWI\vY[XiMXoxKWԶz/}z%@2YRCe)ҦSIyK9|R]a\uBP"/SBΉUa.Ū1+)}Yj<~+gV[9HW9dsNV-xTC5a)7D=6L".ZSDσRښJƌsʏ ,zgΙ,O|ծxAWYk>ůU~erܫ !1mwLrzMe-N$|NO>BoH׿.)rDHe=$Q#ۥ%rƩ@JTOR,(ЖWS9O͟-'/r9_tVѣ:? tйsllcXmm}$?H4qAܤO!{N*D~PϿO,GAj{:6EYZ]Rjj60*\E= TbPGkmîziac:yO*]kڳg sNoʍ5LyQf5ʔ*GsJUj*)H eUՅP}QJG n OD  QNOֈ۴@k盀WR%p$}FYE20brDVdRHFO>eOn^h (I8$H7O ]h/F1nGtGf"#]G)gJCWثmh)jIz[Zz#I 7J#[?ڴ?xoa'qx֥v޲s˵y-ѣԤ́ .7]BVT}rF/YU_Đ[\EOrCKK' \Zǚi^i+_khij[ZI\|. P[3P؉ &w(}f8e ~AN"6R_"zD6A[Of#:M"@3~&4u"r0~Yt^y- ûYiNK_U~v>ʥGOoblpTZ@Z];Ρ@{qWKD(R̵fTqp`{6ZLg%Er[]ccGGT"U[UJ[m[EeuILINa;+m O+ek_$IpMdk'wAn9dLB7u:ᛔ^X-VRKdYZ ~PR?i>e(h* fP ,67oKu@#ow2;yJP/o moIjEOV9hd~N/0mo5ZymR5W@'lv´3ۍ Pme_-X̂s,+ > n& 2>?G9SkAz ӯeofAqÿ+|u \P\Pާ?u5[fWk'ڏ|z5_b=Ѝ̕Ho~+$3\YژJ(tpeVl3[f̖Y=eVl3[f̖Y=eVl3[f̖Y=e+zx{j@ J((b( ?S(m=PJ8% (r0mh%I-!k0UhJB 1 B@c"% C@w4ᄁL %G9~\8Fp6L3a"Cd]~l­~\Y:1NR2wD^^ 49 1>Cچx ~QN?D0BhZ+q2=Il^xeSEz&A =D0$?Ѓ吕O`8[""ƞOK8$v)X ͧ'>gl\| '~2~uqxvƠD;9὾ (4Ui?E<H%3[iilͬD?D&Q?LN̼>Rq}7 CaV</orF Oj>$~'Za&g!iV3yl>Vxg9Ȏq(3X*!tD0n[yR\kZ28++E4ŭHduY-Yd>]Mg a2"dN3qv:u f9kj 2+j:|Kf|L Y$ו=W ]Y/l| -ƌ迾Q|^JӜy?f*A1Qf_l֐Ȏb}.^0Г79׷-syvMYpPfc_=9WE7^{GN!JnL5;63,=YL r=Ix q+\ږٱx̒H~^k5{g^ir}:iG~5#;NV3,e?`֎51D~ۘ@1F"ճ(Y#U&{ƯW)$V_ǢIQBEkwmj`/1E}pg'zZc_E,Cq, \Gĸ~Đ:m}@m`ah>聖Pm$ @/vD hgr%# C%0x~RIq!:”1hpq2r;Bd,}<6 d n21w' 1 ={D{}ΰCTk-;nbpQRcCjVȱz]H<~,wcfqŽm 5KZ`{N0_ף_k_Iiq%dl*XŸ Ǣ.0L*BPb>tB3E'C̐Pl.Db%pSnhfk#f u06eIoװS# (\[v&퓩D8:%?EV'@uFyIϞ`l!q|0C$g&jb/ &se&<Nbx`9U;IxEт7B5 k!| ~W,157`J 9!#1 SQwnĪ *6NL$T^ڠJ@S&4Ȍu Bw&6 /'3O&cG0M٘f1iq.Zp$UHY sߎOٱ1Zda 8w($>%gȄғsx&q#% OplT]UvÐ4MX^CF< Q`&DcG /C`?Ⱥ26Zt2l@sӘVr 4O`s-6njO83e;<66HЎ^6f+ 3N2x@o @ճ;d#f?0c߄gǐnj@v;QF&`6o'TʳzFv&ѡ>hyCP=Cﰓ {^@G8v &z&#Xё T o"uwx|q~(c`U39\1ޗ᥷3qldzP^)?d/.2xx6_ᅜ`|Z/###cu4?}k'0#0#0oa]j 0dAo o@!)|FzU*z5O7\/VK?v>|#B/-P*t Q4rSZ>ʊ|GRcԃ9`jKtǁ-@7tݏ{_jgϥK}&Vfn7);t? tݯݧwtT] Эn{{/@@{@'\]Yt@vN$04=t/@?f-.ݛ,нݯ@{@'@MgЧI.-w2$޹;`Ŀ֢XL.,H,C8A1V܎QࢌF2Z"`E&طc?K,->qIpE"Fn p4% ,PR?,QrPRC&F2R<"|H,Y|ґ#K-A*=[+d$D 21%\^be,SP2E)}@&$bđDx 3~D"$XΥbJ.[bJ"./]Ӕ\iI%@raF& RwrIkI,` pq.iDa򢥴lB%`.tt/˕\}1|~|K /5 x.{Dy"e2PH P >Ν[g ^>^\H(gs|a5P bs$TДQADog97I؁}.9&8Y@^L5,}`2D5NȄ'XanYA _􋴾0fãŰ~3AehYpid\lSn8gYjW&i@q(QGq<5ի.ԯ !`A9xtK3e!z h/M* qi z@*L/0`B `lp.ŗM8p!aj̈́&$&JG00_|N-E K#@CKX+>]w=f ɄN!L'p-M?6hЦlBؖ00pp±i ?oؾKGe 7n#ӲMbSy8Y˄7Zvl/#,JXal6I 6!l٦SOaGllSOWi+ Oѫ+JH[uF[&&vKhE؏p0p±Sg'\DѮE6ޕ !<'=Nx2 ,?IAa1R +Vm߱yYao6'lK؁0;aoC G'1>!ɜIϏAX"YGN!CpN8ẅ́3 %LxSĖ6 m<tj.AX0a}F-;u*S@L؝7ac &KAp=] ^'ME#,DXay*u6"lXޗ@ؑ+a aTa$| 'N#MN8pQ:2W'B0h i‹ BEFIEX$a9Ƃ /X8/H7qPSuGowaux[#_)(.f,`sߞGP@{uU scȟė BX/0FX,fmP:ahI >/1O#MYpC\45K.x>|+z, .k@}u;ufS\ռ3\A8"u Dk/~M@eqT/Xу_ {U΍Śs <2fv]Dģx^MxދS\7$DQUMD71[umDEhH6vstWqq7r''tw[ayٓ9&zSӼ70Yތ5$9Ҝn7ẈU˰¬"Vy+՚n-6Z']N'__G_opߏTbQe*+U W\1Rsϵ%"J JZ1(3|PV .\*8&np\pbpJ3g!BbBą$ I IY1$3|HV -Z*4&nh\hbhJдšC3CχfabŅ% K K[1,3|XV /^*<&nx\xbxJ3χgE"b"bn⿎x6?wm#7nL@oնmz>=[Env'mHFz7ֶojVmUlxQJwõ}eXzl6ʶqzlVJ9{UKV{17O[ݎ΍~7G܂|Pbq=昹>MٛhOdz6go$S۳̶MM#Fh|KaOV_Tu v{z46*p\4oHYs@E2^%[tmW|s*=cޭ Q+'*0G_{(T}EiO6Q{D]?qztУC==kҎ8ym8FQimgzx.+]쪣J~y_ϟwdnrRjAmc?bmcԦֳj?J=z}uW{iNO{~遾i@l0َ: ,3ċ1p7.ce^uHL%UT3Lgcc|u? AizaY4$/P'\[[[燗Vgmu߇cqh 讚ՈvG>p=Klt41ҢIH5t!45Kq$M4Miݣ):_{45٦:wQ??c_3qpgy/WfyF;xYO꓾-U4W]=yQǟ8%w^w 8o:@>(ǻ_5:x5Ua`w_ȿ/ | l@C>X~'%%Ò~#R _z3/ȗVrj.R#HQ^Vj+x5^CMTEDE5EM45MTVtQET33j-bs񬚣截*]kQM}ϫoշ"V}/A ^TbQC-UKEM\-gQ[RDF/uj6 eIm/ڪj.^U;N@Vkj+^W:Ή7EuQ.ˢuh)/ Mvmvyyy&y$/ B\\v5w5%(WkWkA$W]TB"(DbV%T ȣJ*JA*@^z Ӑ_C "<*Q@Az&[D^TcxST+(TP*PT(TPNW)5P j Oj(DO'5B j5*qjTVד$xFMV!FMUSYj U_/5Wͅj/j>P PK-RIuD.2ΕPOFZ޶ZUmkj z6o3T0f`h2U&ΪH]P.A;ꚺM"PyqlXc7`-wrĀo}4-ƽcc4Ƙ^+ˋƛ/R[CoH002X [`p3{`nf{v&y'ۍl]=&Iޞd;{{M~H#^I޾d;{M';m2K%Dw0d]M~Bw8d]݁cioޡ]"睼2c2c222""""S"S"Ӵ"jEfhEfjEfiEfkE>ӊ|R+J+2ɛFL'E>|F+2_+V;B=V,Q+VfVdVdVdVdVdVg*jZ:\Rd RdTdVdVdVdVV6vNn^=Vieke2222"G"G"Ǵ"ǵ"'"I-.)"""g"g""""""W"״"׵"jEnhE~ӊC+rK+leLVdʘ<[SheN"IMHބl ,ꈗEKJN"=1PAb8*8)N8+Ή₸(.⊸*fOӀڢ6pQW!`֢ EG<"I$W$d`;"E|>1ALPHl0Ӿ=Le4 "cFQqϰEܛпw/}d"n;]M,#ȏʱ_yÌp#m11"F>{@.#5\ېa32 [OlnSģsa 0Fhca 0&AL)0=0fL3_+ _w÷=G Ȁ9 V*X kЏ6& W `;쀝 v `?d8p 8 p/:]p ïp~; n0f^ &7oF1&)oysނxkކގ'On~?̏?O?ya "/+*Ư_ [Xkj [C0k5hMҬk5ԚnͰfZg֗V5ښg}cͷXRkZalZ FkbmYۭ.u:fNYg %uպf]~nXY7߭?, 6-lvn}>fO'Si}>g/Ke}վf_oؿ7?[v}>>3|.'}g,// |_n_#H_^_>_~_ߣ(_A_!_a_c I4dT4ߧY O{=(9*ja|.^S4on'ށMdbb8cX8JŭNP:IqX !J @{+wwObO'?gsYeJ^^sp`q~ s[6egl[))͖{zʲUhO4[l[6xjzj::lyӐmg[=m_BǞf?AU+aX?&ǢkaCm(x?w9˄Ph0{rCO--P2O\~9l1K Wb ƼdހCv- ńQw$ ,iD#`1%420_/2`9s7l' db.ScVby.H\'{$TeWm ѻ7WBQW/z@CU( u6'jmY[iݞԒ2W<+N~1CA~E~M~H2YlCP.CAB #?N~(7Ge߫b*=dޗIU\{==ܮ}YDaaXaXAv  K1>_b!>JF}5E}- MыBݩ@?DU[_#.Kۛء .G\\!q9Jpւ1%cE+.lj"s坢;e/X|V&nr їUf.׈b.W5Y|Gf )k5g'o9\^ $ύ@'jP]t-d+M87m:Ǚ㺨;uzHn$m̶@f@[!mvHnG@8 Wǫภ*}.׈'Q}*d_\1Z:⚾M+jI=Y ]Ai - sKd 1D*bBp({ĺ5˚g-\\\\c6.>!1)9mK_ 8Z䛈E"Hz$#~srJjZ^hihYhyhEГBO ::::::z/~ЅǡOB> }23p(g#*FppAi0,<"2*:&6.>!1)9%\ G"\|1 s2=?G}اMk]ؚ]~ k9Ϧ#~$9ߤq*7 7Qp4}w[QWζM}9 ] } |w?%w ={h*{[6{QsGyDc" M73G >Vspq-qq Id~? 7u">&t[BS⃄!Y!()!OyjӁjJ\iՇt2.il󬪰G"Ne5D1"{,Ii'%{h&RB<4Ԝ_HL /;n`7`J;nasbw;PŤmm#C+}͓sdGpLg4',5fʟv53 _YVO[[*cb=ufYϘz.DZzY)@_^hH1/Sk#}/g*t>v,wv|po N6%)uLZb-rӗ1.k5?F昧RPdC]%ʷjs糴Uͪ71ߚ'.-\ o .g]:qob^7-E0O=¼|V"~JbK'wIQ-y(;-TCt\_2+Zߗ̎v x=DR{85ij/P!=19f&۟#Go|oOt̞3e=L{&Ugmk˳n}?T^h/"{1հWҍ*{ c+ s_#T9CM_}W& 4rЗQ7]b7rA: \*-# ̼"o$Q-Y Vʭb}=` pK9c8vvʑbF ?x͡'K8|q>ak&g=Yt4/m58ì/Es1;/gC9y&[L5.u\.sz\ֳzْZlO̳9۲ͱմư6\vs.njseڜslιac9[ڜs٭\pنmeqfObgXl;re'֖e5|=C7.ٜݙisf9wobIZvo!ݗ39ȎySe){0.<,IK4U3S p1Ves3c29tDL/XVQ]ז7vk6֫{%zFw5M+L6.m~ڪio}5- G?^+m)7O'`FNFnj32dl8q6@$P?P(<x9p>p1Sf692sN̽ey9 {pTpVCB Bk8J}+I8-\#ΒpYxQxCXgYYe=%dֻY_r\1KjYbtcב@Ar RσRH}H ysd?@{@9A99C0@{#@9A9 y@ ǀr̃ /x@9AN99 $E /yуr )ri X$WcL*![ml1|VGR!VlcŦ5VlcŦ#Vl`Ŧ+6=b +6}bs3Vl9]I:4 CfefeQ-ʣԑzQ q4Bzr|l!r}l!r~l!rl!ul[7c BoL!abXL#iFrh7t.t%Db*C2_5f!IY ʺzP6P6 fhVnm^#hcOe{+zrkցʭ)mB+8Rʭ籕л!| C>^v*yYX68$ַ [moa,uB۞Z)hcUxFxCŬT.ylIjYELM#jm֣XYX[kkԈ#?5RkqҬ)ysC>nU*v:Z ^qO˃ko3şV-{hcDjL>UqCo):Rn>_IsBC7o~L;̝boN3wb1wSE>D3h#f"桙Z"`PC塙Zt^TezڜcqO؍mlkaNrٵr2{J +W01 \W5=b]t'!s= 1Xc-hשkV3m }Uv:kV8eSC6W` N\zKϥPĔmx?qJM^0sH0u'&)ԣb'w90A;˲0Zd@gEn }A9)an|z7'SHoͣS1a$kxZj>^,_t*w:ڮ3{/b*rnnq-ހmu;sf+ϺAQdYy'[oOf-$x<YP}=f:ƽ_J̜2+܏rʭ̟19r n6WQ->ו1TўkU8+ ib2 F$_]-'qwe~#}W=UěIOQA5b5vC]t<)\.@Sr}LZbXғTPqWHΣ *wzJ$=k#hg} / SGy ~(쎲J/Y-am/lޠE H+jIPH - )22r(qTFXx|j>$UhKx0.s1}9 9WH>95FE+42VhŴ7qd5WɅ ߼kf<,\yEI$H_ܥ]Bn yը,xGtF^ FF!==xFDF7 LLO)d@I G1gju\=_Ig=#y3z!9=}!zY[T?_j5GݫSsQ>UP?KmiN~n{^&[}ͺXߢD =Xizg,] "Io[3zަz>1}J/~GJsy[~_? N5Sùrj;N'ǩ:N'i4q VNkaU9VNasd ?F:T5SݨZLjF]j?W?UoT' ݣ3t5!Lߦn=VcN{i~A]9/^%ӿiӐ~4vNS~Ԉr|FnvCnG}9_!yX_/W?yQ~+/?*)RBYjijf,UVRL-W+fE=quBT/S:~SSԇ#uA^}kB7.tsBԭtkFt{AwԝtgE[D=Iߩd=EO@?Wz^zި>d:A'䄝,'Tql'HG9qw\1﫲!?ȬdVCf bld62MfBfA6!5w@R:r\& R>)OUr\#ur 7M=;@~(?'?3GF1jƫ jTea#D=UQmRAuHVGQ:~QR_77u^]TߪK겮ktM}kl]G:WuFC(=Zc8=^O\=O?ez^+)ܧ[}IY_WU}!G8sd8{ew{; dRt[y펁LxD}Lwf9c=&y?~i'y^nz: >y 8vMGUxsCD~V6xz{Iz*a<U*⒵f(w"%)TsYNg9QH-{̌},,I9 ʋ)㠜Ht1 [n?[!i( 4-k!-`[߆v;=y3z]Ut=Z,ߕ\XIu,"GV؈#d8Xu2}9bM͡ <vM++:5:"R;:?:dVR0w89)2Ls4.,0~XvZ'G͓RI[LFe;j}er~r2-Ia)üfzT]WD7`dYe5ʑUEL qQ 6SGP ˣo>lA5e+ٚjv=Ցe'gՋ>/5j(K8hxUKğN+6Rȵ]t?_-)kh(~n+U(g'ݠt∥5hώ keTZn7$YnD(n=*W1w7n-QvEm,Mܦm.֢m'N[vn½ɽ$GsMlq݈&& fkV28#-wxZ?͒]WSzAQ&GzQΤe]lҬ#laK)gM&9>k ̷xm #c#e"7' 9R=]+WUeS2 gKɼ¢\>!y3/WkUa[ &Ҧ_nq5 ip<ݜLR.d1rh9s}?5 ǦGB7R3ISKGSkp-8۞8u@\3vu͍ͥ|% RآT{4 --[ccORilUl55_Ldc8n\/buSs0~6_yWĖUWSxڪ6j@g"BXZgIXGg>SVR?_dQpO~2VSY[o`MSlNuow#z^[-nǺ jg8πWf@"؝[2+5r=}̼!w"ʃÆU9_J筤z^E]s"ys~odIeN9[Ta_r4|G"rOM̧@љdc.&xno i&z\~;;܆kA'D˄XKf7+>os~ǔX3>{LĽ~8( 10Q}c"6ŠESDR2r0o9 ,?Gy ;| }Q^a"^/Ǻ3tyT eB*PaGf;D>#߫?4Ϭ|jiKdi?dIOeD?qf9gI4_IqYpg3k¼>4fqfqcL!3[%fC#wk05 l3k̛#<V<}=E+DU#bn,U"4t6V^ 9W yv܏խ#cy$w^ww}׼HӁAc9^qϥZ ݟ+{掀IzԻnB@#{r:K'GǮ%s_qPתq}*f;1ȶDUU f7DT[ X)R5yy6g5w*\'8k_`MqnTf$2?E*CKAHܣW"FYXM vϻ穥{ͽF;cXmd)Κ}ܪ?''R,w:P8Q-xU!^㵹xxʋFAA,[㥔E12>>>Z''Rj/Ǜ4?eb,]ycj.*?{ǑFiȖc!⛭\gt;Gis9MC۱tOo'>4 c?O|a'4_K៸b'V02 gK@lI9TiS(}wMIěRh>;#ڧi]{&U}rgf] L;UzDA:K[zG^"" *+UPD UEy}-4b/("|'.}3d2IIrr9'8e rܧ\˯ GhnN s= @A\D rH!Mȏ =sUgAݥ2n'F@^9k}pYxߖgmU;Tyf>Ӿ۲i;feIFqPi?ūAj%f!$[)1~s|W)QeP:ΐ[yoOJy|:Du*!J5.O%tE]J̋"WTE?y7TOߡ=Cj?{ާэ>ꠏ럨>.Wy>;wq<~f1+Q,ZV;˫x5x5x׫Ai\%7F fIdq/z}}2ku}bdOެ^o_n%1oNޗ+*=>́NOO׀%j ~Q7h_D]SN7ڧū2$w>o۰cz ḧ́Vp\VibW˗-6/S&/c.@!cyo?JL yW]GZy$t*t9H+?(@^(5z+3/$$x{dMx -xmV9@f"異3Y̳jvyn-Q ]KyHYBy.,deM4=g!+Wo3|s\_y9Ny}n`./D76MmjcZtezQ[~fy{mCVlKVEJ"W;'n©d">+-^[d;IPΊhs76>Ø c\1pbˆvC.Ҥxj/'4cq2QFQQ e(cZh:1(5X{utOfkߩy3y*̛+)wzTu w(!' ʈh zž'K|«򯭘쎀x9ʙЯK=ϻǿ\ ڝs"Bp|Dލ\iD5DQ 0~ W!9uG6Y__R>.(lV"BLuFhF 5eS*x+ydIx)1ZfYX9E@JRr@YoqB9rlEwc8SH9&eRNŤF阔=H9)Ĥ|1)kL~IDrǤ<1)"bR>C/& bRDJ\LWH-R/Dm͊}PdwR!xW{sF3pCb4}؝˻GG.ts떸K(]I33>>9wZw-{Ѭ< $gmdUb;=,1i>ğԿCkR(=/AʨeH|ǫ/$V+}vc|v+|*wYvƮ$#\HvC'x7|Uј{2?u!םgjO4 kWYԘG;]Fn4lft)Ik\rJ(vmsOs%kF+7WD ;ga}y%'@6)3'iTܗZ9Z2lRZs֜9/3ڪ]W3|2d|5d2d M\8% -hE+B.Z rꐋք\kQ}]_7ƺnDMu;ݎ5םugjR=zR+_ )nIq'H;CRnditd!; ӱ靐ZXRleyAE2""bdBF\*W35 # q-ylv6G;oD;[772؝x_2ګ:cqٜ0[ڳq9|VC]. a5@ ֲg֯t8Y$9ǓUϲPZ,BLw7Ў#Puu_}BEEt5(= k@A%@%yP:mZڦ1V8^yzCA1&`Lǘh1c DKAMv^>0&`L Ø11cb$(cxL ;p=QzM&]zBT=3 }{;E?c~tYC1z 8hkhk%hyjZzFf77o9(=û឵{>¼F

    xG3ҟm̪Wws ;Z7gA/WcNGu=TsS!,gKBkPY5>[i1XĊhl⻬ieǢDcc9u׺OJx\xFv1|p?ҕX^gFQjnScaM6OyHSڸZ{lk1qRtS)  & ˢYBed9YAVUd5YC֒ud=Y_6es]}e,rMCNw{}r|Pΐl+BX.er\!Nn/ʍ|C)%-ߑC%O<*3O$8*+' 8;< M'I8 wSS)B NI$%ZZP@j zzS@@_@ ( PL)Ed b)Y\'-KʒddiY\YV,/S~YQVLeUYeu*$kʚt-kS+Rayd#*&ftEBe/ًJ>d?*%ATZC&QY9JrrCX9*r$rC5#%)I<9rՕ"'ur\J j ORC|ɕr%5g\%WQSZfr\KzZ R$_&Zr3 _ӍrBVȷ[t|[Mm]j'm^n۩!wPG:ɝr'un"ʽUfyXnkWak?ߞk'%Reޭut*zs4zgef숟gSթ9qZk&v8;'/I|(Kq'qCҟF9>Mn?/$\nsOK}r?ý {π|]\OHO}S/}W\d#-gi-Di+K;,? [7t;4C6ezJj 緾=ԫXw >3ZGKy,n0by[UՀՁ55u7[(a}^-/X/~b/&ibxXKr=Ol[iboO d88N#:ŝεLex&h3@GR4gHCg G,twV8[6#gs9d8s>/їӾ"*ZVξ޾a1;}|f--=[{omvN>go|?~?Οǟw $䭈c`q` `I`)`i``Y`9`y``E`%*jZ:z MM̀́--[ovv x+0      8q S>|888|880Q<|B"bc%ǁˀO> |,9*5u /_n |*p35^[RJd/__ ~.}p#Yiǂ^O.>   ~^x zKRO}_zW^~zw^G/o5nc|o&2V6yL^#M>d&لDL~Sjb ")f1ڪeuzvڡ>f<̤&63n0wqf`&$slJ)mʘ)o*T6ULUST75LMS{GS5Vikڙh:V+l[LwsazT!'?1o"cm꘺7 LC46MLS47-LKsien07{sL5nf&2vk4 0 lafaFQfPc\w +0;̇#ivfk>1̧f9`ҕ㯠y^~Ď{={F=-au젣4rUό%ijMs#a=ѭb`<^>~̏;"1+/:̗bμ=J 1^LbXZG'Gz5\_ccK!hE5VA3g/WѴu3Kp/)<6˓慣9QWG1ދ'zi c2/ /z~RنJ|Z@ ]WBVd CS0+a00+a0J(a-!KdMaNl̛>59@{ߩ}sg? N/:OLjKLjKLjKLjKLjKǜ`..>\yd p"p%MwqVI6toĥcĥcĥ[-hEr:rD1ދ'zi c2/38[%} jim#xG1n^9V^]`?}AQsgk~SS!=uA A<|6+ p5p2E> GG2;eNS;eNSFN4a=.eZc9E=R,ERㄵc|ß}f>'eqUo.XXg V6"F݈w#nysx]}Wp9\}W>FO]-^~Myh" sceڒm$Y Q9{.`gWۀbyO_]8x݃rh8 xB/WV@)b(༘sf\t"Ts;W\ssx%x a l]y& eR&ؔIU$z8uzEpkjῨ+x6\K{0s۵Z][eX''fzj~eNuܻ)Gkb8FweoCI#ɑPDELč\))).H8R#WE ER"EYE`g˅ᄁ|(OiubVg+CkW]B'2O?!Nrgqp`A>q$\Dv'cl$9A';a+puxu;8^)"NQs NIK;.Se/xyQsCp;9YkFž&p{M84Ќ|恞O p'sf`J`3_ 'G`|$% "_OȻ" ]5MoW$YGxsH*Ԏ|Is::&uxԅVɗ=)g=z$ɼKKtGď-)GʣGBœ5yZV̄ux帵ܾggd%&RR'ɞ e,,,,,,,,,,,,,,,,,dKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKVh8I}DuG@$:-H %t@$-4Kx%VŁI4^$@ŁI_$@ƁI4a$8rs1`OVKj8Y-'%dDuKrN{Z"WKj8_-%|DKcsk[iӜm}C Ul{*:J37Y؞ax]'gW)'+ѵ&k[3b | xҢSX X ts@gp6i>ID`!o3,X;&n9 B@&[a5""V)^E^DJmUj J&( .1!U?=g]O}?sΜy3/OGdmNkw㵟:xcN4^3Wx]&w%*Gf؍o:?I+zd%F'|+'Ƌ8gI%~J!}>{gt\&^㚼6&}D_@('A!be{uGׇpG?Zu@ce;b&:Xs k+F`ghllCviK&"k'd/z)B<"M})w7mZaZgTf:md922/65o4ng5߰dG,\Κaef=mjgeb+-ymm{}s>qEUݑh(r,w|8cɈi34fb̘1+c6Ĝm1vsqqq\ũJ|Gů*\BtBvB~Ba› ;$H'\OILNM8! 8qE͉;$H'^礐48iBRARqҊuIv$H:O<8yBrArquɛw$H>O(J V&(JBYlVv(_qf: gssss>28eBJAJqʊu)SvH9+9V،t s35B8۽v3umo <&Oh}Ő9yoh=8z=*IجM&@z6WXã k2uNVڤFVk;=$>bos]ZEږGƞҋܦ=QL3.+^lʿQ)Q-jӝ͕vc,,iK\7(+m1 Ҷ͗V~~[]exS 1GZo;>qD笧$S)=v_I[&)ieb|6CH+#;^iI2\}ҞNA'q i ](ji?v{CgcO5tF11̬3Z%tVꙐ'Xi 3-vrt I+W§D`Di 67lEOHeieIϤ,iVF3I~VKZ.[o$vѺ(_c8'BMb41e7yiiTh*6-e\N5m6m7020303M9cV̙6lsWsywr%y,Wp\ǥ"" E2GڥҾ!}^Z ]yLZՓ>6r ˂Snɐ4+ViswI+7q0f43fU_q)MzM/2kCwvZ' lQMF}Za O 1tÕoph .~t w}0t\]-uʼrw}`kf osa3k˂v9hלhL0E7㝌&u?3tFtǚD=z537+_Aѹx 7[i|*3Bfk2>i;rCr*h<;voپl/ʓ[_|?go2~Cs ༦Wf2#Igcȝg Σ2Cɳc\yty~X%XZ9!v\C( ǡ2 cB?o4M/ VVVV_V_oC?J+f}xx#:f<׌'i#ψ iMfT`Tyf=si7f5A;*6nZWLy%g¨!Bώ ϚZ]V/ }#^1>/&Cυ(l|!zqNX}eB g#7Ic4Y7`5nChvBX&Gy\5vZh/l^_V_V6z}sh}RDX}|X}khe Oo 4:>1=>$aC?VV*>%%^VDʓiaq?y{c[[ۆճջsaQaa auWX}JX}ZX >+>'^VwՋaaahteȁ/ad^=ۖűˆEyQr>Sg&ޘ1żcNaS]qh3W Ӓ|o֣[-(bO5)dLl,(])(S:[%a,kQ6W#ĕ.XV(Acy'X;aE٬l,{)r*u,4)kRzfIS2K?Y-F#mhY,_v{r>V>}J;{J?Wɢ*_5>kΝ[wl,[h,ceH)l=M[J{Zݓz"3JMPʔv|kw{W륝ޭ|mΎB۱3_ǡe]2,Jn1݆v+Y/֜svoAq 7=W^kdyg 5*ZE5)ݽMH~`klEգmvvͳԶy%g̓.2ub2eH`H`hj 5l|^'(ӆ8jFqW~Q Eܟ_1|p/Hg}~# FIW=qS/7vss9tgNڹ sΝ5wUs=]ؽpT2w=]^\sV4蕢EN{L*Ͼm?mK篟u<۞?Pl-N++RfA ,8® g,\зHY4~цEՋ3OwU$V \J fԤf%]o=?,s3Mi{Rא ذd<2u b̞+c%ֵ?5n,y2݌~zc} n=EN_nj1UcFO z5n q߶xrKof|7s!zlz(ᤎdErxSQ\Z­Џ~_z~zf9XlLmSoϧ2k1Q0;Εz?5lFp'3,VU)1Cr繹$8o}Qz ޙѯ{W{I)nӴ #uQ3Qڸf5e=R ad~-D =+fă+RmpƴKtm+k 7J5Yӷ$4dA%8ҷӪM ]M[c'jR]-{hr{ cwmR.Xn]bviܥI ^R. ,1%M3+M>ӃJg~^[ȳ=tR_ ֳ8Ϯ{©)[?){`1NDӔ~nUasSOkE/aŨe˓M}6itsՋޞ'Fo.n)%fPܰYK?g%ǸZΰz&(zOd l(z{OpOcgrz]4QGb`r778zyϬ7tޮgY}Yh-Ee[턙;UyaaevT8&- viK6T6M>!LSD Ӣ-r@+&FD6-hO[џVf(2߁;Wg8xk%ڻ`FtrQm]kh6QQ$"EBOTj9(pkP `!(R,`9 a|7{M _䘆 `f#Rxeȵ<&b,@̴,%E"]mw{>G 78'EzdVyZ%v[#v.n ̄gavbc%6Vbcȱn?w"'H&(L0<1ZûȊڄPpbL'aH cSD1wkvT^8mmm/03&1mie s'Fhrz(|e}#jϖ b1ӪZ$6"I.i=Yz{I/bn2^r%Wn<=%lx]}>DYIK?g5'$0*Z?\Z.CX"nƚMʢzkעC ڙQ0Dmw$4fc@!"P/..e !5* ޯ_+M_EQEQߴQ'( N33PhuA:"_pI+o黎2E׿FOxbPPꪰZeI3j+-`WX Xɺ13}L313}L313}>LLLLLL,3c̘3& yӖY ?7'o5>fYc5>fYc5>fYcP2 }(@5P+R5|DQFԯkDQU?  EQ EQEb(bJLmoda1{^ߗZ_[-XI}RaT'I}RaT'I}R:WfWffOfOfOfOfffffƳf+YJl%kɶcD::[&lP }.QSaT;NSaT;NSaT;NXZd-VONN*8MaSJ%{ޖZdS''WWS+J@OaS]g=>9${f"]Ϝl9{V}LkZUzg+yV:EyJ\@*Z3S>s6==!?}}}i=ei`,8 xflO$2:z_{j)*ιgΊ gtK '\'3 ON"}lCg]xACȅ 0x£`0 0 jU_:xޅ}~^-a|al-1lO`"Re*Nv_`=\3R牃pn3s'jG#vk {௰Jap|ZUtB Bkg[ZXZCF`wnޗi>QsnQwjUQ-.h wk Q5{-;Ǐ ^:S½6ZCY;m+DA4XxHDHdPh'@*A:d ?G3h}73.cvЃka<ة{v`:̀y"XL׸H 菨o\*ڒ5 ?lNok*2-HBD XHΛ! A'@*A:d0ZhLwAKZAkh@[dkA{t tA9c= zB/xz@_a<QȃA0Pp#aƿ1 `,E ",2x :La5/ %g;.oa=|#`74m_> lv\^;/ v_a/>ZH-Y,RK~,,@:?} K:AƋ E"xd2^/AƋ E"h"> lv=> /N 삃">H'@*A.Y_% 7xv[рlVk}{b-1[,mX` xrOi}ρZqZ'ٯW~ P&GlYgqk*zzg{?9c[9c[Xi@+ QqڥxHDHӮFCpG%T#Ȃvp?:c@W2o7Fh@D l`@,A<$@"$A2(H4H 2qF3h8V=@Ɉ#;9}gL\ݕB733~tCxnv5zcʽxnL7hΕ>w!,Ŵc͓kI_oZ5|H#oM\SiwgiWmB`3 -M mvl"דE<ټƮdKZkl"nyzUYex})_4~AX"R10g@̄YP/i*⛊o*⛊o*⛊o*⛊o*⛊o*⛊o*⛊o* ໊ݴQl}aqoMǴ/SxY+%|߄}oR|/R|/R|/i_=<,i_0RUʸJW)*e\qQnVnwT gI#㍗f:o3o̮zfW=btUU1*FW2nqe(F7ʸQƍ2nqe(F7ʸQƍ2nqe(F7ʸQƍ2nqe(F7"UDT*"PE@ʸE_" .8L\q؅V0ZFDcG4qDcG4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4\DE4qDcG4qDcG4\"Px!/c'>tb ؔ2O mO?2/2/2/ceq12Q8G(cL'ҡ`,KNA{ `Vnrq3- g,v;תŰ"X Kx`FAntFAntFyA^tEyA^t8A3~cWY㕬Jx%qs7zJn%k[ڭd*cWUƮ2v]e*cWUƮ2v]e*cWUƮ2v]e*cWUƮ2v]ez DƜ{tBt#/UF5=NNe4b,ѫzG ҋ^/xK/^zҋ^/xK/^zҋ^/xK/^zҋ^/xK/^z+D"}?+,'xO2=ēhwA;vʃW*6I88%ʪY?=ղԲԲԲԲ}D_%*WJU}D_%*WJU}D_%*WJU}_<1 xS0 x  , ĆDW%*UJtU]UDݿ3py!sxPvѮ"b1.!%jZ"ĺ<%"_̯cы~tּJ; 8 8 8Z:Fn(Er4*Gh~4ڏFѨJШJШJШJШJШJШJШJШJШJШJШJШѨѨѨѨR cԱBX!u:VH+R cԱBX!u:VH+~4ޏx?GhѸѸѸѸѸѸѸѸѸѸѸtUU;rߢ\=գ\=gG=\{_Ӷ%P ֡`(*֠b *Qя~TGE?*Qя~TGE?*Qя~TGE?*Qя~TGzTGzTGzTGzTGzTGzTGzTGzTG%?*QɏJ~TGTATATATATATATATATATATA 0VR Ѐ (@{Sm D6             : D4@tNi W W?q'u}{;22QѨ1ZcKMڞDRӘ4^ ^@ DDaZ#FADaeq]Î].D9#qN~ߟȌڻX31"n@ 7 D܀qh=@Zzh=@Zzh=@Zz he%+䯂((((T]Lʆp]]]]]]]]]]]]],QDK,QD+P P P P P P P P hȳP,g< Y(ByʳP,g< Y(ByʳP,g< Y(_e]tG/I{2h\=cKXǒ=d%{,ciHjKX^mG+fJ"~|[rSݯcOǷ׻<[4=3:82z)[c&9NOlVs]'U}e]e]e]|/{)K^R|/{)K^R|/{)K^R|/+2+2+2+2LLLLLLLLLLLU=ZG\cf}Ŵmٯ,1濩4]FS} MnvӵݩJm tk];Avеtk];Avеtk];Avе|̧|̧|̧|̧t{7ݻMnwӽt/ҽH"݋t/ҽH"݋t/ҽH"݋t/ҽH"݋t/ҽH"݋t/ҽHbU=4~7:v O^^}_ ck__ w o$¶ĩ'qZx"qf)=:2wQWZYI"_]/eezыn`7;Z[Tvyn߃wBg Pݽ8#p $ o5~;/ 4~CUhF|x87b=N^Y]c~ݸӡ~RG{jlXgk7y;Bgc?ΦaPc +M7{l]Mb=i:9V6GՍTQ5GnjU7Ru#5{Yf%J(Y*TSLHJ,P@,[)`9 ([)`W^z1bʕ)S,XLR1ʔ*QDJ*QDJ*QjR*GR1bJck1KbJ惿ГT~n-<{L³/gD"duaN1Qa1Oy'>Cy\kOãHcrQ5{;uk-2KjsyP]kwUc춮u+tBތ;]sz9<gxV]v;z1ޕ<]<'^{/*"("((c%ސ°pMBMM 551/촚/Z\{W)ѰBF{<>LJLwyj.jj{m:fy>x߃RI_`~u:nŶ0) /6 MuDZ^"򬹫i&lfyE_:e~V _E(i_}yjpnc{;oy5oS5sDM[Y'YtVUa/e9d-?]JȪL߿¯9l v:n[ooP@wt3oym{Pr(;=CFNj 2vA}^- j;Q]ZTV .<#&TFQߕH鉏 aoG蛉c<DG'.Řy㘰r *J"d(/Kq7-q'kS036<\g;>7ã7>byތ0JTREX;=~7lh܋ks&~aCSqP)fSzG~!^ *|A/4}w8QsOX#ɰئz>&nb&n w㞰0W/FTdQ"jTyuqG]ad $:ee_""Y.+۝""v(W§EzQEuHzT%b~.bDZQ9xs.'j,P>F/ kGG=]\){T+nݮzPV_ %y*oJ|]n[뜕srv@{\.X(,]VyU[ך^V`+T5*؊z=&*ؚFsG㭸 wJY}ewߧck<;~!?_ȧIN=ۼk!\/<_׶|+Ϸj;^n$߯p+nʱ,y=JV%V|1JU|+yl^/Q5GT]';)&SSm|#fxl#{eMZ*ʬ|fl,F #WSL22jp Z\-lY[-뭖VhkdM&Yl,*`kd7d7d7dM&iIvjZeV YiIVjZeMh,2K;+P)t ElQ 2CRYj=K:evZRE~;K"~_-W"~o}h$7VѾIW|(o]uƕ0%vo"jz狚=캀]R`^vmff6m;ENE@Sw|/yN^^gy̛ЪV{˓g}g}zy޼F h>ͼw's{\n㱻)}Wxof#&;봳N;ի@^W2juZ]^ӊ:jVSN鴚Wl1_Kv 'G%vvwT~wL[*Ӣ]iɝ7&Z{&w[ƒvή׹syg2Fw6sS|K&FEãEyAi'$#+e$cPINvn- "  "  7~9&2Pvys7xs7[ ŀLRW6l]z=+;rvsYɍ;vWR +% _nk8tCФ=qZVO]zX6=c -ְX=M>Q&:8Ϗw|T?3)E5vGun5mD5mX6f۬c5lsq}7f~o{ms=6GǹvbYŝz9?U:Ghǭ>yu^%Xg9`l~PW^Νhug2r*PeJWKgqyŠe?KgY//h=f1kYV:ļnR[(B^_` +gB{_Cg}}gY9-ǨF6{~UWo^+^jQ*{mTnrۨF6 S/ۨF6QM| f==uOsn5GGU>)c:ܣ}>e~*Icۧ}>uOWԯ>uO4XɃ: ]+Hx~j۠ìoU?8˻/R;:J[kU>w[s6n0;:+̣P?7qҰՎ{C ' ~x>NOwu;]';a;';eMwt;Mw;hOos|LOdhZ1=\_oMYsڣ+~?-%_"B{^+[sz*zl=z~kzNS9e=N9gygƊs w[ ׭tbq3+M"+ү~{*Sp p 4,p pniXa[hEy3 XfiXa1:jTZ'rYfR"9䨑F9j䨑F9JtR!GrTEGg=vcwU\tyó/AkK^2G>2m=dk#h2|?ODׅ{qc E9go `~ԚC{I8q*>i8g,OYs9|/p_a$_||  DG׼^YVռX2aUpor.u3X{MGS}$,tpxlа>PppsvpoI8Wu+qƅ'릆nwh?>?'$. 0]o6Y}1ryb<\X.O,Ovdo%Ї&Ie5td}r^.b^׋zq^84,c1?5vzӨF4O8)VСtX["֖%bmXkkToObn[ROqSQR72uGCT?0'F\s>>s\>>sk$~>OoIZVɢ3Yt&62]ƢXt.ލb):UVOGGԞZ{aNqQtx혰pKqEEve}ەo95ɌSۢthXoщvWaxmǞ(\kq  ;ZIŤh)} o"̩~'0S4':X~#̑_& ]ߪ;`8N Nv<gD)>a1G#̑?s䏹:TwoWLi3Eڔ~wUY^F)rVl9"Y,9wDDДt?Cߵ|>5*LWj|%u#MJܤMJܤMJܤLŽ}131 ~9xa'53<CrcnM`"&V܆q&N܅q`*}131 @tx)CGMaHtnq(x+&몿|rtOdlҲYZ6Kfi,-el: r: r: |e:N( :N( :N(Ȓceɱ{&1\*V?ďpQ #eӑHtl:R6Mɦ)4%dӔlMSiJ6Mɦ)u7ݼWwn^ͫyu7ݼ;\ooooooƲ4zl=-*Rԍ"FJ؁^bgd2R}̾Tf_*O'eD=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgY=}VOgٚ #j.W5-~2*QF%ʨD(eTJQ2*QF%ʨD(eTJQ2*QF%ʨD(eTJQ2*Q,bXnXnXnXnXnh1K%Z-fעT`]RҪPU,]kQҵflj6Z5]ff}K]Fll#Uʯ$=qx<Ѫ-+uiU.ʥT*Jl T]ttw.zO4HKriU.ʥU*VҪ\ZKriU.ʥutA']IttA']IttA']It҅'gs x$T9G#]-sW*REShJM)U4Tє*REShJM3c}fό>3gX3c}fό>3N n؋o!&T*DyʜQ濬/k˚濬)!gJș >rr&J>V%;ȚY>REOr{B\HDi>mș(r&"U"g܏c>kM9HA~pSGN0R6yL9G3yL9XXX:yNG~M\A7!g:N"Sp{*:i&]{evF֮ j_jD2?KR]}ָSy4X_E3tQJ}ǁJ:0,NK\wQ2,h`*F#0iGpNDbbM­ LƝ wcJx!ZZ³5:ԣ4#P'k!KjF.KjF;jF;j䎚q. 55bf<&F܄q &bnmwJ4܇130+kpM;YfY*n>4KGw1' K?ػ=1Qbl& C ÒsɆ%S!&Ðdׇ:olX\kq  zۤ6Mmzۤ6Mmzۤ6Mmzۤ6Mmzۤ6M.RXx+"VbևvlFd ¯0yо.[7(4xd3q;l1~~x?/-h/au^kǯ#uJݯC?vbH#8W™arpn4:ׯ3ۧt/U>l[ѩaWPԵYwZ:iOۄ(~'zrf4(Uso1&azK*[ʔqDȺho"+GZ6~4o鄊y+现!o~rW+=Q忛TnTx#16+磴 =/]m {!l}tBtAC=4!hDAKˉKq[C+uR[rl4"9W':\0pc4,?>>Œ>Œ>L>==¼m-յZi|ؚX.^ܱUwkcSAW|އE״Ey#vYgKͧT~9qE;]kWogF'%f%Yt2$?<'$ } xEν7!$$MQFwqq@MEuD@QPPAP?QEU "L%@H}oսH@TwuSNU\䈠hhz+J(a ߎhGıJYWb~?EIo,Ne(@B9@Q̡h]{- ]@7<͌Mԅ aF.\6r!lBy3Vp遖\Y1M9#Cl P -F=/,|Oplp]c68c>8kǏŭV,ȑ%60"g!P PKZa/է}EP}phnEG!X2-%G@Gbփ:kfؖ^>+g?t9tN1n"T#tj$58 !rmHۅc!dd1i{MFWˡ3FfAY\P'vr# 9:rnA섬uWkOtn! $̦|1imԳ?6U)㠇1;t Їi<6z:Ҩ$^ !|2I:%Z+6+6&\7aΕ]B'BW7_3 DwQOi6-Goީ PlP6y'j&R2/'LpZN7TرQ.R.Ff[v4wr!w=*KU dQg{p܋,9vt^N{!K#) ܲЉ(?9^{! f,GSc7d)>-RE[%RY=0r},mО=(Tہ?4;tWYqs5BNUjȓlթkPZ3tG5\c=SN`38)j[^Hx-Z|ÇNXڶJ\.9UJ/ykz-H zHx\juPzU1.&w.7w:up.EsBȽi*VU5^:ңaڸ^ip>Mٸ O*zbge@[HM M-S>hL;zMX;A$nko@_FL& |3ʷKf3^^fs-\6W(EHdDHbKEQ-Dm+,@4b91MESV4:B\rE+њmm,O\*.e[rM\)duz/n]]C(x 1bŧS BbXΫl7BfDxk'iȯr8mx;3wsL>Yr;G/ܐ\b7MK%/|]ó7g rzz;9_&93B_:9N^hUh+7\fǹßgc ;ܷ}姺_[BAan~Ge-+}2(3PY,#lO'OTKy?ß!gɫGY_-;e'Geo8 7ON SA\grhP5HÂ|9ԗ~A?9&x*/_/ȷaKWrbj ׃q`|4#E$1"DE##qOcDԀji*ò"׋z2~QݡѓIJlo1£r:Cגچ %RlJ(s }F:q>γJ8l(eEzި/[olTk9<=`:晴l,T 5HZttުw z]IRen>E[{̼[PzH2]WeЖ&VFo1.uOSzbKo.}G-B]B_oqh)7v#(眰vQLP=j }jlޣj{Q1)& 1=Gކ:[ot$/ =.)nː;밳KŧlM[B^zRM;9ZC:sЮG]y#&قN;aEzn_r'ašU8y_9Oeo ,ZNǯՖ72~c_$|D옹 ص,Qq͠&&OãcܥFU=jϦ,85]gԸcH`yٔ_9emFPVk,]b-a}lGCc Jόn9*w5o!3\kSA2.c^Plf?QH^pS7,t>|uBȧ4җݛ[ ۽%XneYGoX?DͤW<foa nċx=oalazp qFN||F4Mti"rI?_JIjihhVVDDD~ ~Bc?QaL(&|cEXQ,b(`(h(VXQ,cEk=VB{Ufwz^ UYg/ëxC%aXNng=jlEX ca?}O';㳅fϖ9>J3gYf֘9>[g,3g6w^3gőHHr$Ȟ>YjYЛɏ0M6~ޡɣ*iJBS̀nn[=Lap] m+)BY>ͫI^ZvSmڃ_K.C/+YLz)^V/}eJA;},WAG+CG)@SYMj55jj4* &A_9(ZGS'Y ۡ\js:9YGYt68[)lsvQu)xg2VkZOzn>}: JRW+)RWڢ' W#u RUגRשSAW$0-D[SMuUՁ;*S ruQ_RUR0GAz_O1 e\0мF e IFQHAϤdzzx&rIj2~>D=|>ELQ_@ijK%s<\j6jVS FN֪ (kDfܢRMmCȼKe*BUj7$٣>T8W:bUZi t#G`8=p{#Ā# $nЄ& 4}P?J0Bp&_;( / |ɡZ-%uTsquRFo m6lf]~~!hv{@߇E~ žݟ* @R"+DA8, D*@W AԠfPj}ݠ.;zEq8pLϷw) Y C%8 >aMB|2}4"W'[`-V.g, }I-Yb/b_ž4}agX;0 ʺa߃9~qC=E<0X"`"?Pb_pCz!NjhO-[D!@At.q7U-A\]z)]Żd*y5D{ebk,E]G2nT7bŒ-YKuD߾K݅nPޣꌽA4e-.h=T˔zL=f7 ) Z?ģX7єE4a-N V"R )n WIXS, :pMpm85zKJt"]Z)nݔF|ZA7t[$k,Ubq-Zŵکv"Adn)b(&,=1Q< =zDZKP?O(T)'"JbJe $A-vTvF|"@bd E,^TR$"n"1H R@c0rP=D`D-p0QbDň5> @J8Ʒf.zMe/oz6_))뎻FYo" a=[u0X/vuȬE׋ E+eۃc{/t{=wuo]G+OqZVV_2Pjʵs M;jwB1IJO۴5Gzz'=Oﮈnx cǜ&o/umAhO}HVnziz!4cd^kB <*"ܤz;p$/V$2Ԇ(giǩnhCB]mE0Fttk[ɚƓӕSE>jssѕ%5ʍ%Ta[9xj/cط>"q>L@L= >5?xW@%@K^}s|{| ߩmnEJ_Am%. ;QB)4= :^ia&&xQ+ʸ^q\nsOtـFoWK%#4Zǽ2J3i֍Mz^(<ȑ:ɾU˜2bsk'Rz v`|-0ͳ-=ϕ*Eg˜~Y*+O)7>c ѣכ'#=1=?e+ t syF0Ȏ=S)Ț]DQ48,=S,ϊ>Fqr.ROcȹb,Z:'rҞ&@xZ'6JCrvc vC=bOB8TߠfPfN:<5k z;fƣVVleG~T5%Ocq,E1GjᅰCgrz{i-ǟZ>VO;*8}`1rb-GCS4ڮcg1+6@S^WY48գZWt*0)&R(==cf?cXwk B{qc`LZS1;{fK,v-u ,6Ø*v`O$m#+V1'I%]o=?c[ed}gz͢ Z N0v_6`\e>طBe2;GCHUļiCZl-;?lid+kq|ǁqy {l:W󒊼og;;Xqe48X%dMi)OoQž%H*Ay8/@-8Xp[嵶%&O;c|{'1=-v%hvk% rR UhTG}t}q@1FU'Z>f}aVRqrEWK:So_{6tQ>va︲m%6;qz}:|ϴoc] |YͷoDUebi&%_'6f%R}=^wz.h~8y3-;ܣRiG)+Cc5">^|Т4gM+Dcq/SGְ0DT9'9%ys8ߏGr%mƕXL4SkcY|f)*;kKtW_}M/:=Q|(A_ue7>(旲7Nzpx$rp$&G] z8KN֧У֧@S9֎NC~zzzd(6ƧM3>KSB4},~.oFy ~-4>h _B?B_Cy7ޝVGc/*>Ol.L93>6/O3i+K|G;O|> "*K×eW"}"A$~ D/+ꊺLY@ X`}E/ (z,ډ,Itw* j|WkLufvWa<^7:Inxa]xa/=/=n{xa/S/ÿ0tƗn|Ɨi|lEgƋ_hE+m2^qg∄MEs%xWʏ786x?#^4p0G 7pG7pGkሏ D#4pc?1 ?o6"xk7xی7x"<≂Hƃ##7#P Q<%ZFR5 o:Cz}5ɣshqcEc@7ߢo-݂\/w;xwS ﺡ(UK%S?aO),`J_cUc4d 1kBlnXlܼ=/RЦCZ =}j9TBP FaXmbE@88-]9Ԓ}~?Z@؟#߈D[=o ՀQO|"j@ZkYDD ruu,.~>йy!-FW]S]Yn`>:4Fg*]bPq65j7h\n:`7ro-ZjŠcGrۺuW.VΓb@8Üt3EW7Mg%;o9P3ٙB@kff ?1Bf >MJn%jbFjgRw)p(pq3_)YnRVHk5Tٌ6#h6(nyFvJ6# *p [҅nw7${ݽs!^Q+{%JRHZIW0)K2N(a&!}SȀ. *XUyd24W(A!3}mY:+낾lF%˳YH?[M g쏫gc3clFp95#4`(JJ}9Z?1r y855@Q&ʉOL9YNFGt8,?g;UNEr(A9K~_Rs3#} ͏rhʅd\~K!2r9'3e&raUrA+sgr3eh e!j` ybt.UDUTJ*UyIM0h@P U#RΦuRt:W T3P6W/=YU]՝]U];b "" (""2 !2 (: F4vEEhL#mi" ݏGcǤB9| }::ZaIsM /i ă1q=pOLs9qir'(rjԒZ9sj#_'I;$Vxpx0CC,|C×KTa&p ?,zf䁜rB '6W=Wϭ%]~7a~]'P'++=.gWWJ=!u쫤=)ŰG"_f{ ꌵǢuuȏ{L'N])T9l:77d:Ӟ z=Kj۷ڳ}=5ooG͹q}78 셐 ^ۋAKQgc^i_ګ߾W۫~2kP^+Mu:i04{XZ؏؏H7{8퍨ބҧ@{ JWvin?o΋))lF+y~Mۿ{e;p 8߱}u޵A!??v쏤BrP=2WG@K@e* @F}"$D)$ THT ((JT!Q9 hO"Q48X3ׇ,#2 )BLy1>Ly1e%)&Xz`2ꁙz`2AQLF=0dQLF=dԃ^zЛQF=è}BF=Ǩ@-BtE"b܎M*{6XBjeZ z4mh3e'bݨ+ Pj 99mvTׁį݉_{k55+z _cːXǸ ye\<ۋnϗ*\B[4׷6$mL,TCUrX@T}h(8?/*@**D#WȫMcȫuJ=%g0ND=C3tUFiȫ3k䂓ܚs"Fm 76717&n>ha@O >bXZI&nktnmt3ABҭ/%@ })1ˁW++{Ib厁m+NWs_$ ,lFpɢ1]բ7t1qs9H!V+{Gc|>77 $pO"`ݲľAb1nO۠&e{b=؞@QZY{ZEVjv:¬=V4H<$=|4N zĠ b̈́Zzuk_X˭+|YZ#DEz "$e'kQ_> ”MvZ[Ja"bʋ)@I"ˎDW=* +d$HdىȲu: _v%,"D|م>J”[_eG"b"ˋJRJ)K);S"dɮҍ1@bD] A L d)d``7TVl[1ofVL_쨾b2ފUQWlF]ͨ+cԕBF])dQWLF]1ufufԕ،RȨ+&،bb3ɨ+2ɨ+6b3J?F]1uE]1u%̨+6udQWLF]udQWlF]1ufQW0J_F]QW1J!қQW2J?_QW uń Xw 5 5N@ͤ$2R:ZZKۆfpQ}:A#) r't! ]:C3\ Se+KUɨ(OǦRBx%!LU@”!ttMMЭ$˪BIhah!J'?O()6Bw-00xh#Z)STiP?t }P.tp1JrB9!)P #PSSʋA/;/ǃQ@$|"9rI7x$C>| _!5ks<\:><tBx$Щ᩠*N#1Nv;y@1.ʭ@{t;C.DS^OK/ܾ8HW90Id i4pоپ[[敟И~BK 'nx -4E}'Q~BS 4'4PBCzAUBz!'',zm!³lV6{j>o?;'__Bxg7@ߠJo<ߣ :a 7h}H; zg_'6c`fgG//WQ1 R=FAj(H.㨝aH- $ƸH .cI#Hy)#%`dfH>*jRH,GNjIu#H-J-A#(5a$8JG(5G(1<ۤ<"C]ԞO?ː_Y)g jYYԈj3S cjxLD3eV6@k ؇/*]X-ww;;T+"](ڦJJWZRz+S)\G:)\9gzG΍*sKjEjs+I礞N=NuQe~飔$O>M,ogytI_"سZzS!XJؠ~25ҹ&oks8I'N& Fz HAzReI`_kH$g=I7n!JAOsR7K+RS%`\F(MA"ԕw5ӿ :rqUWp0cH'r. BTi(a C*?f$w.d*+b\2zVyH7Sϐn!+sl#}HwQ "'G 뼩r!;IWU?HHhASRSaVWBrSj5hzrUe2脌hWћHgdt\;HhNeI$]DE7nhEѭM(t_EV`C)xؙ0cb 5TQ_]aAZ ;ILsf׹͹C S,]4t;KY.MwwVγV)r~J::;u:q5*/$||aITRx:)^8>K)I9w}UQv̄3@[3ee[N5'SR~ v/#?KVXP5uOˉg:My&IU廊xU8ZqW&]u[d Rj%:&/it&v3u9h2 g*{k_a;IזOA"(utʝ0j5P9xϣƃ<躀64R!:^Ή| :ΣΣcctCu [-+G =zRy{0w+GF~9=N?Z^\GGFN#p;16Nl8]Po3W HVk2gp.gqIβ6gYz~s~/:q7vQU;f8p^Oxc=tn5YyZ,B|xY\S1y KHfqU8-v9y> mpjt4WEڒSkg&ю#!\Gui[eiUV e_( X|9xKEҴ>nARfe5%AK%Hs, _P Y6"u&ҠofZŋvp)_W g0V尲;ZSښU.>\8oJG HjխXЋJ7:-xp<^jho=}| [@!TуM5yW&Nk8ޫܔ=˂f˄5Yدr_ns }뒚V|k %"_$k9 eXSVӪ*!VP&VC_ڕX%f]PZbф WijOc(sJYMjZ ~1feYoV[/.~n~U3>s-*e0Z @OU5w2gFtxe#͙_^ff@.F#Ͳf۬g^f__˰8C!7l61[մ |؀_ y5I#@-S351ف dluIY`1%Q&'܋~܀_#pmw*P(5eZ%cTLQR1`ATyHV(9d ~$'0$n46 utf|kPЁ#T5U֯BiʟiԽ}=z3߉etYvqk^jL>CYz{ubճN\QR m ~{ J7ktUZc[iSyށ̦oZVhCr 0if4Z1_M􍤁篦A_0N`M7}Z̓vTd|+^K|=٭֭V2_[# ?mpu2 ?b5* _cCNNM!R' Vڕh%RWk/)9/>œp+kq} t;'֘P]ӇZI5'fΌ VzD|QF+UOn$DٕX[92K>©9*O'u~;٪ YkefV];sxe׌Wlx/}y?]K}@j_Hz)=rqO9ŸӼQڧ+k&׻fec8PT{V,0w+Uw|BK#2*]q@@j*oh$rI2?TYN cxƥƥ"enqq=pdc2 c<-OU5漂{ D^'z荒sczIؐ5 \^A0㎑Y8:ս}\$^H!2Vi#ř?YT1z^#q{B9^=Uf#cqXrұ/53+$!ᕊ"V~S)zB^9GoF iaԬ,T<(!$ˮeߎ415UݶmU&9 IǑ(c.RY|J2'$RU.m@\_~"9fC*WUF7dI|\}CRr7#\/W:S*}N'Smܔ{:}W]KykY5qK&~?$sVSɦ!In}HFz8/s-v5 mj~j~"ב`#h'bօkZϵހk=")ue@b7V5hCcg|Xƺ!=ȗBz{>t}@A'=z%Ae26ͷi +nVp}L,UpKγEþvѲ(x `M{$7tyt9JuuoFI$AKnX׎=#VT̉]փnmس#vHױb?=;&v<%}-?~Y|(WįXgEE//]Ǩ%24;A oQx8( -ݖ=4vv; Zڸ\\""KKEw!Q{zݽw'P:ٝ v$.;W?&A^^] z7tw0oޕWyWv@: [xq(sA/\-F§$T?In? %DaUxtob/A'Kn@o'}'APu'/qcI|JhIF|i;ĪToh2qA?OMMc^yB]\MBL?y~35/5)wdj$ʑjjƪ1T=ƥƀs.lb!b VU{6Q\FWٴ&\oXq\AYQgRtO!FoSNG: ?iOgS/2!:wdAˡ՚06L :3KtCؐi|nJ?g+(/Cliɚi[΍d7> 95Vq|ϻfMGd_wqjqNd͗+ӝ=|}=y?Q;^-'Wﯣd&Kw;f֋q/êzDbE;;5֋x)Jw&vbJB\k%:GFJ.0"%EC~qt1Kѥѥ,vУ++WB2 #: &FׂPF `AG#C _/Yr/_l0Ca1%%WKee__ WMğ_a俍19\W\\ @w TsnnQfOu/a0E"L|&_cDaw;8.F~~ 8C{JW ^x"Ot c,c^B>A>墾E (1/|+D\N^g1.^z]bzݽf1^Or1ȟ|x VzЍ]]|RxPg ?oPo(üˑpFz#Aw =\+C~WNo'*kk{MMy{ΪϪU< 򉡂PPPP <3֛-} _D  Z.K_{ R^J`2x~ x~ -|QVp\^p\A?'Õ˫oF"^x7񮌆-/&>L|(chcih弚0eK8iՀOpK[jwh1?MRѣ3x 26NTӀX#m/Q` m4vۈ.)Ξ{n_&;e'۷o%.%'*%?%u)HISb`2$d8+^2H"̗d2Itv0::R7yfLl ؇iZ%{zTqQ٧PU𗥏?V9 fRYk_y{reJ|HodOTa' Ū>zQsGzթϏ\j[Yv|5%^5W,Vv3bg;3vXF8ٛǚkk%XX mcmq*L|IJ-v”'bj<ޗb ?iOc:k|SWjUc Ua.Lc.C8tC848ΪMh-ҦEj -2D "sh:-RE3Q h2v]H:ô3J:cBq hm4FFiy\[ nɫ+t4 U B'@7H(q ~[g/i#1r9G9]cV ͌fu;ppx_8"~~4{Wgq96ثj:wWU fM?yK\g5~J|&Bi"%dKMSe/ iϟgCIOT|L bH&} n\7XLGPo^%c Ҟ ٙ^%-^bLZHܚX> ǫq:ǫdq5 WդS5L*̷hMw0 CdsoM4Mw40GC\bxB!1#Gx0Byz<q]U|_}`df22m~nݯ[}E'bM |"|2w5y yrE×SޣIM{. ߧNكO*p|Ɓt"Q3?v=>3̭ktFyNe#R?UǏ/{[?"J(i#<_e /躸D|_qEk]CU$ IR120ڲ GJ&eO6$Ơ6Ơ3֐c!bËDg U=) lD HJ&%aP2Z%GP2kP2i(gP2(gQ2(P2((,:L6Jfy/?ÍrG"gpʳ9t~F!QBF393=_650#5!aN9pMDcł)5c fR(@t udAM<<ZX&fSL!Ylf6L S*FdD`e>a-A6¿ ֓DY"V& d6u1jIVJeRZ-ՇrɄ;dǯBH@^Ϗhpy%:'i~ m4Dy7> 9srjB6ZzA;Q( ڿ!9fm3AӶkE6Ls+sO\r!%E8_zM#>1tNbZXqֆ>X},~>In |[T'#~z5GXn}/kh aLscH2$\WV @b  Bk-ϐ' ç "+ E"d(1l! & 5g{I|}0פ+GmWz^BCiY>96|9a:oC(Ź8y+::Ŝ:eAwhީ^ڗAkڇmi$uh+SWSWSאԏn"SEW@,ɨ)oEϷ|/i?|vMWvϢ$:r|R!bP8L**:v6W.&i_Үr&c9P?-Ga Xg IOMMՑT?˟m&V%Q{omh遺*c rGIys 6Љbqv2쀔v(W>&DWSbH>^E;AYՀo{YRޛIKHLlB8LʧQps.мϜ`ǽ#EǴ#%Oj ffbƙ άpm#Vm2@~I%"~'~N}8~ki@\ku=zUěL|QE]/ާA+#uzA]^]H^}AҠsQעk!}UеNAA_qM.RJ^א=g˸bE1}O_п@z ުzJ|C_&Ziҡ|[yw,lgy(sak΅Bǹ5+֬ < WcqN8g px˙G 0g<1IH$*u8s-I 'Q5IČ0Ut%c|>+58 gp %:MgcӖ*6}.F5h҅.~CGkH)gHX${iS^'eީϥfBm_ˆ߂>6iGWb^2>Kk 88;z."_p}RC$>,|c:G@&œJ`a麧d OG{C{C-=40{^Ciq/%K{l>zw_{ڠ}U*3k¥GqS.k_[M4}4㚦OM:@>@WL>fq}Ӌ2 e{':ؼljدIؗٱr`U@(O׉@UIOģW,2j/v1eJ\SO9y >'Uipr|lĕ_k!ɩJzcځt>Q-kLua[/ӻTUߏ}J5Ɏ}+NP7mнzX\gt]]O:ނ>͈j?Yptg|eףw7*{q#Z(=*|Ghb}"/@brȁdVp9 @P"Cg1mys"lZƁ~XtD9);}ʱOYcYO9S MKF AVګBi NɂH|C.Iw=n5*]N1x=*k e}Q(XDJbJ"%P$Tk_Yqss͙OZ:n:?"cITK]q[3ҰtN ]HŻM0 MK!]eO'۵4(L{=G=^`/Km7mv,7%\mCL"$c7w*dko~~~ޣH !E2r#1aJ}>ah/).ś;Uuk+Er NI+vxT?|7ga_7?=wih,h4!_2^ bx|[vp& N˷ہy?X=C|?`4hp7Nc˝S[q 9Dtt{22AJ&lW&, 'm^[{zD0Zt:6ku1ݷqaN1I)iuzdg.Z/[Yo@{@:n[mI6f`v2lswmm r8dL6UŖr$YKULwqY\5^uF.}ϔčpc87>*7 4Aּ-K#9\WqĹ81 r[9/vu\3k39;uqǹn(7̝.OpLG9RwӐmn;vʝձ:!^fUwmMkBK>yk4KC،`o%CN%pɜK,\&mL)pyl7WP|+Lspnί.s Nc"Z%#p>NsG,\>}un˼pږd)b/t={%) Cv/l9NNi[ΰ9Mrq\"t.[rl9sKAoԼ|~|ќeyE&}bnr7Y%R'vK)`Zr!h$yf&0)t^~3@@.1Kp] th>C% J#*S1#L& @n ?Ph'P 4BM@ı=Q@=@}!z 4>LSH1;@3iqDoNQHP:Pz Gr\s!' `Gu@ۀv5E@Lo?uu5j> tJ9ZA; 4Jb.B̗tЬ,wJKrLz87lHyP @6yg)*8r@R UoVl@;v#m[ о-r>0_>6O?$v;?Nm,29dt!z[ww66vҫ~&x}hRL&) P˘i6Lŋ& arM!zS jɴj:`j7151ii4n0]5MNfLLs8s"uY|Bs ,:\U#t?@::y|F0/6 #Y-*Q:ё͒da,KFY6 nYJ-(.0h ݲp9,mCÖ.qKo9c)!, Ґ떛ۖi}S1bAO*6Mf'?fsŬ zC` N&V멿\{P;lH[p l2낢.짖Flkp\I-`5sN:nb#.=\ ~ ` x; x; Hry"wnqw{,wJџde Z :IF@/&k򼃢kk nna lHjvY[~a9 K4uzMeK%۴4[-11V h675ҫvښl{mvQ [mq6bS'hS4.m^ǧ1_Hs  ΰm.=| ~ `O )J5Fi-.( ~.$ `2l#6I(J(. nv mÀ.- aX8'\%+ua# i𐢨 b0m=$j]bl10O,EhCtn]1η^1^5?+gooۧtʑdVJ4G#ۑbaCt M#Gc1q9? Ui1B!Rnjc,,q!2]YzYV\[ZY~YaYIL~':Zmar.)lOY eNB?\H+;]6h.;[6Zvb0^CQv nٽY'q6LBdipfsnpntnrJN K[۝; }gag<;qu[JgÖR:99/8/Qy-v^g7\!GrUyByXLm<F{|Id_B;3hS>'ўJt.+]-^r͹r]BW\NMv\u+mFSkk8]N1Iӌ8tuλ..}[{ R_d>YT*2*UlXt BpUx+[+W**UF"xEwEoE?3^qॊ++nVܮ_Эr'Zw;ӝq nvݲNkNtq$k)07w{'ipZ[#w{=`1qO'S;q?0r8#WXbʩUfU>Y[ deaeR):+=@eFrWMW+;L*OV< Hrlܶk\\[w+Uz'j$1x2<<})-tuO)"<.Yx[T<;d4Z="x_|u M"_IT Fy~[}^_P:EvuZ8W11桺R-H-NCt_]WMW7"cAVnE~ăTs(/,/c{OVOWգe-O".Zx<X}^<H > 0cCHF`<6 nDDǩ@]/ p nBW #5``k`{l`G`w٬t: >A6C(Á@w@o_ꐵ--p.p!p)p%p=p3p;0xXII֤ddO8555&kWQׄjkjv4i9P^s$ph͉1@xD՚ɚ;535`\01Ա}`Vpls`a$h '(AO0jp[QÃ{[;cSh|brZFVn^p-6ޖ&[:MQTd+6vڍ:nkj7i\T ~v{ݵ͵d;mj.vYKkv[K!^[Zmkkρ=VRK+oޮNׂ]Y0 %CZS+@(-ʖuk[('Ǘ Bt!w `>j R='t :X֡'B=>^ P\B4 TB#cbvh]&CS`;Ͼ#b\bܒ"ETn"bDCI 9JQ-RZ6*RV" E""Rꋊ6RQK}usYf͚53dܑq3t`ؖx)Ӥ^"U87!9 ?6<(};;;!^JUUMZTj;_U.UW7pU[̨*_U\U^5[bNcҡNUx[i۪iU3_jiՓzW-tuժuU6WmY꽪OF.:\uT܌YxN]CxI|L|\<1>)>5>#>+>7~_|qc+/_oo???M&fDDDDDD%%%BDe"H&&$&g݉ٞ NK>>!׵ƿ20)8aTQg5UggMՙf3:m98wrj']dr8^v3p/u'~nν` wE3˽n̝hsoqsy|ڼ}}>>m_vwSwǜu}?O;݃a.s9=֚}ww;_w/mn:un 5E==|S*oNfҌ:?x척S!35څC]C  844Ƅƅ;hݣwФ^CSC3BBsCh|á02V_g)Kx3eg]urȺb#11̧ͧa>c>Lsν\s)oo(/oTsG557׳e֘;/U ˰ mԹcjZ[-jr\u~d]buWm~V?* T{u #:5}*OuG0L''ˉ/De_t?˹_é_imq—9NBSL ͔†:ӽUrFy|c )';pDNS#j>Ι# /T#M[}( A~oՏǧ.ҏ_&@?gj֦,5J?g2U)YއsT\?f5InSSU+5]?muZꧭz\iWAO'O6i꧳j-ꧫ~.TO7uD}e?RZ0LçzMgk=36SgQF[htThOY о2j_YXu13bFL 3i# Tq1Y;UH{YT91W6U~vXgSacQE*f1>J%f__5_/P_&[c7aXݮ~o=z*PXb:uIS2iN3@,L L L X, <XXu:mll  |8884`V0;lv v ', ƃ7'ggs .>|,WW_ -]ws0x$xkw;ayX{>cM?]`]nE%|lyS6lVb}ƏX{~%_[{ʸ޸^]_b烴ߩӍj1GP:|qqbEڟbF^llv^bl7Q_/We?!ٌfߛE˔*ZZ^im?w[:}yuh$ɳhO{ aL;%7c:eI޽$O׆;@ PnOGF>FVM''ˍZ@N;`I-Rwlܳ5ܲyIaPQd5S~|_LKč*nF+w%V~u!¥>vi q(fHɋv~o(8(h۩+:G ([ۺqJFL[J'+ɻލ%Pzq+e;ԱE'n9GAiwڐj톤7ѩYqK\nAi[InF)ߗJ8'#}Vfk_.y[awGڛv:Z|qz _>ndӑ-}6# 6x\3cR# Yn$ddnǑW{v9~y5Pb#ON[cY_FNM#7,kmrۥ( ]Y2z>d"*ͻcuʚuXbўWJ:V=pKvVY%nY֝ucT_5%\6ʭIˍt8_Q O4^ײn7NSQz]+xh&iFUIb_W3iT$YR)~mlV6^#L렬pԄ[Y^ܼ]zwcJw[GQ{]ܾ|_{7̋(#WRϏ74ʓYm%/.:l+?ɣ߉JW?Xtqm ,AdEN :()kG<}ZY~YWSu/_6, N]zA'e7w =C\e-.{1/ʮ.{!^'x_Gxu;ơl{.>k`I 1L&㝲}ei(/Nۑ$n̤8q!V5s1]&FجKI8+w}#ҲRVdtR?&ثpZ@3"Ih4la [7yihoJ v7ylg` --79kmu WX*@csfО=R)Yg)A'&vb<&%Sg 3A|De`9\|D?Ϋз.UFU`Laa#(}W`Zܱq˃]յCXz 3EQ~&Ka?:_w3+W^muu d~aj#2 V֝ҸN_8h^]b3us'f`SˡC }$IA]} p?^z* 6Qn)]wA?.z>|跡߆~:?gP8ۡC>)h̀s;~n+3(5]#2=:zs  8K0зBwWO!xd0Ӕ}HFȦѼ&#pouLx;XKlY;ھ\cx&t=V3p. Г4vwA_ uꪱ[9MޒY I:ʙѪźg4f۝[4#Rin)n ߣς 谮> 裗'3,o\i/== /&%/KTh[ {ee@Kנ8R!3y.ё/ $`gS)W}Cw]Z?uox~ù 5zzSOL}1tw/؛=_]h/ya-frNfte/=E#TӋ:35^^C'p x"ȓ_Uޙ'Td6uIAߏ4QоRτc ZPӻw'Kf7A{<މHUwZm5o䭛Mټf~1yt_m x<]C n<^ |%X)H~[;Fp<)׺A5xJGwt"-"&,!J|12q[H1/K4+SVUΑ^iXEC-5,]ӂe{46]m-46﵄5w.{+y}Sgu mc.W?hșÌC[h~A#Sgfg-xFК'xXuAfٽ ZD6^"]z+8ϴۿvn= #5QkwCNװg>"g{:f˔vmji$6d{9wJtɞ1>Kdo"9my(3:M 5-3|/$%:nC3j[Чe݇x*-N⫝H".A =K#Ca\MmާNskf4e, elUNB#rǧ-FE짖 iSusaz4~,xB|5.؜Ny;"RPۭg=JO̾O *us*Co[Wy&|t%9\̂NskuW }V Й+4"B=>i±M8; BS_c-8ȟw#[ZtČ OsQ#=[(u7pB)N2yzN/sHe59䯠Q NÔmAԺَm);A}~Nhl#{ {rd~ߋW9].m>Z]@ɛ?8Mp8s _qB 9rs|NvK(ڝIzwsKd%gHS9!?C_!BN""?=W>09 7?1zdDJ;#ܦٻ? jI4'sƨ4^CK 02ܐKr#'cSB`bIO;4~.c=`u̎+{k̥ivy>$K6lӑ;/T!'r"]X{%x&;hi/Qɍ _9j'iyLZ.0ݰǡ![{ghy.51W/\9{Y }l% 気āEcRzj0I?np_FΠgH:+˭xk<=pZ?}TT׵{ t$C(1(EC`J;#%>Kc1Qj) Zˏ1gxPkPkZK K%>{FbZzo;wϾo}3p{Ahx1kߵJqKyH!ݘ=ĞH!6Nw$xW-" N'8'z#HqK<6?Ƶ9y @w|%#~/osHzE6b:w} O_AsE ?0F8ZV~>Kw!lĥ_BL&4<kp{1v:Ĵ81V)r 1Ɠo4ϩwx2߱ƃ:4}OHj NυwycU9/ Et ݈w[v!B_.Wfn@*¯ȃqpFa.K|h'q^$Fl~VmgN)8z*<݇yj3"x.{{Qп?mwʃm yy MBt˟ UH#I<.sOy<=P*sK>y*νA5.F*^ ˥1|Ex<zrg"v; 2w_\rɃp2Ԉ4w w=<sy.Q8ie]jNriax.|(8ڸ,g4qŭs ]jَ"U!+y)aZCtbh(xx}@ 9,~#:rM<KӞ _FlVP W 7"y.~ _Mv~HP*~A 2Pc(tQB22:2 yӞU< d䋐E繘 OpZׅwg8- ?>Br:$ǠT+%@y7(gq\~Ck\,! 9B>I=bWQk5"o 9GKMh6{֌<#I$W E.!d9:qZqw48=O&YO|-<O4wV@+%rV 99-ڡ]q'8;!'$thM'TpaqZ={lm[g<,% Zia홊Luhp)O94.gtAgK:4ӁtU\ 8W=}z^眤RN':4y%tCC6 JTBQח!?Ac$̂"ʊ3@π&l70k`g|{5#@ÊDXt;ol1a-Я~t7n@C<̓?C!s2A ^Ƞ"/E%ؿ臠P(п{?!oBބ' @ t$jjGfIӞ?RXVccGk :,Boڿ BU5k $t9 !2#!34A8=haxċuV7&#==Eء/};m{Q֋R%Ѫƿkc3BU5ux h؉Oh<4c}(c5c549oN\cŘ?D]?zfBLO~2@9|3.0w?~ ~ m$IAE)/JIwMh~F(ȜGKΣ(;|DBK^ +?"DgE,wJ2;:]A?={g=%잾A;^N~}D/2/Kt_@/#/b'''cMԅaZպw@+΋CYJ[ 7>>^EWHZk>ś$j"#G,hz gPi}4G>xF+`ϕ~*^*ޯ:fЃ0FRHPN{.rs2 <K`iҷQAcI1l6?#л@B&mzA?1 ><>.a~>E¼x_ VDd+AX"V?/ϋg? > qU|zCvXYw} 8ً8Y| :_ %bac (ۀD_ `Ld"(b%+QyW:^_󛄸+ { U>.bU*hN"b'߷oa 0uux] ,a%A kPI=,8(9/|}E%. 1We/{AÇHA'9iSCYHϐn 3~>C:;X18.p7NiSpJ=8apVC'ӓɦz"bȆuM =Og)eJAo!5}Ji_o;NK {>g<7$#F'nIdI\KJC܆ȞH4#SȞ`=Id;SɪԐUq=Fх,dzf4oJ<%=e0HIO38=Myn*@" U^Ok4xg9P_H })m$Eߦw{)@:I D#LRz$~! O^O4lih#Sod\#Q2DRzQ6, QTC5(_hGZj0oc؊S2F8g('q8n:۸0.W-׸͘3H3m9[D9i7Hqn)G9ќG 75>fi1s9ӜlΣr HbsY\i6MT~5fl5v V^1ny5~sZAԒ+`[p5!]|͢G\d:Yyn Y&t_#ZKyEfʚA,k5Zh-c-w;Ze潵X뭍kVRnk/,jC|5ZGǬ)c]-^e]ZʋϱT#;Id5pg$We/G#4ʧ#J,de4HMl&2RQY L5R\=,*"Ri4R#kȆȦ.*GF9J`K+kF-ɶ({ 0Ov=H6gOe[vjۆ3<{AxXO=rc$ B0C$vy77XLXvXIhPqmJ@\f{m&l&$ԕ&Xa: ]nzCa%!%w'[W/FcF5>Cm6]ߦAh-#r捼1 !B)`9Q'#^b"!',$,!,t|;*Jgc a=acqKcנϠϠ}Π=S1w|YF|0\)Gg68< $>OۜѠΠθ:Tug;=<3͕ٝ7} 3^1:~'k* V 9ڱK5]wmIm1^{MYfxLӤ̹_$_jֹ~ihkkغ/ڂcR[fҾmҾmR&'>̭n|#GK>OaLC>2Bەpǀ|ݙcsO|IyseRlaxbcw\֌I7 fvd1IIo^ry{Q b a[c\Im" K(Y?XSv |` a :(ְE7s3oV˫Ofbʡ.1\t1$6Xy}˶e I|mYn\eqCʢʚuf}֌ z{ֹhv֗EEkˢjzѢXƢXƢ5fu 73r퀯={Z#֙5HN{")ϊ'SFȾ#N#3DrG$S#GhT8!?B{sdD8zEhޏؖ?B1@dUΘP B1@d#[\yc#Gh1`oڗ" DK>#B{&о}2B{|yݑˎUgm+M{Mii߲r5in1/[qne9mv/M= >vL^;֯./Nk]{&[io79χ>?ۼ+rCUcLl<b²J@h"#46Z;=vBE&qqK#S%B !ԥ29 PpU<"!',$,I.'"&!w7vvNNz W4|ZSZ/m4!ӽf]s1Wȧ9 &CW>>Z5&ZKp#,6kK +ƿ+ى֩W&h[ ۝vٷdůR(YMLQ+S+3le@Y,SV* uJYiQv(eҮt(@ҍgJ+(j:Q5V3vu:G.TUju^ݨnQ)}NuW=R)ڣ^$\FYiL-[BMʀfZ P6mR^pS=Fu5nڠm"lжRNi֦Q\˘=&xz$c>+XpR0B: cX@'giBp?%|MKâ.>g'$y_M/ϰiz/_g?V;U+lyYA܅@s]Zs=sz^z普w.wy>7 ^;^s+{Vz+j"뉧 +ZLk*du5ZhGGJƼox`?ӟD&+ׯ#,di?/?Dz/qU&=l hnyU.ah^|R>Ϳy TQxoa,T)<x 314I/1o`M`1!FUAg1!g8_LdCly@^|vyRnurYnwȭy.wȝr-˽r/(t%C(yJRJ R,e2_Y,NW+eQ٢lSv*DP)Gc rvRHQ.**S}jV3l5WW*BUQ԰jjZ;)UEyi)uZ6k :uVuîz]jOPգqzZJ=^P/Wk0a bw@C`5|V@ ?-+UFvpMaaBsrx|T1+ŋɏq/f=3x? ɣWՐBKȻŽA>5OS֍Tjqʡ^uGI4- ?=3:RwKfw2 s{ Br1M.(ΕCR`F` yF=xVEj:rVɫ5zy=XYBVGY|T-% PĢE򑢁P|L>!Ou6% C]EJJ%rJ2Z$d.gR(JؘVPKVj\gQ2W#,"j0+z E MVvvuf*m}rP9%'rZ9\ \"jm_!\ .6?)2$j{N9/-[{9n%u%J,Z_"Ԣԗ4#A򞹁U}4Pr@a#Z<eld#clT)Є_ t, "o#}#}}{7oo./Ϲ=;Dw({XH33T `{zrmPmhCucBBK jB+1{BqlJhmhChӃC[CCBm}E  ,::W3~ݘ*s!thiJQ͓٘CȂ,<lGr7Tc,y)G3P DvTiK4|G.l:btCðWxm.ۍR/ը'"2Es%@,=ŋp@/e|D3bZS\;yލsʵν.~6GCfppnL`nL~HgoF`+9'?v`W;<`M/ϯnkT#`0*_y(=H<ކ~B?n~` Xn y|j&a``A0D`VϩE|SЖ[Fi[)*g1j n"%PFiMF/:<З W#Pi,LyzRQ0%(L/*f`/ug_YٳwR)@SDD=PDnDDД"SM#"R"F\Dʡ)"FH)#RA"" ENDڀ~f=/ϳgυHz*OO.<C>υy.ti[~A-Xz]k/{rlsY:BLڥ3H9o;91׸ qK:]~S[ݪMk;]o6-Y3}|z>7񞿓>gNqnq| VP)sSB0iW.Zy}[ZkeB=0_A9;%,)]-fFnUw}M¦e5 v}wVx:޺;~wҏQyc5I^ IsI|W%F??&xZo`^0>_ rp` &5ywz{#q\\_}(s|^}S~_?Xx/#>?џ"L̄\r_n`#*_7o%~]v-`hx8щ[PttrqOA~!nb넠R0xckœOuقI × *KՂu[VC] ';ŧIu{Zq[%Œ p]XG⮣`PIKɒa%#KF LL.຾dC4,}`MM%MfN=}GDw\pJpM%Wn/uJ6v  D T_:F0^0)$Y:McnE+XQVt[J[J I.IiO["g9pJ}Y epnYϲ~}8c9 r7زIa8lz:7+]6O0  V 4n['Hl;(;\vLpt9 / ʮ[%l9.뤜5M6; ŚAX% II9TS@Ԁ` {B:5Z1!OLYM|CH b``sȷ v Zt}D5uVpAp9䊫 ՚v]]z=L@"]%+`Rzj5N LON2I36=^)gZ9g5˹Y`͜y&$Nm2nuߨ@B=IT_&S3z58ۄ9M5>[{Z Hs_Υ/ ?d 2}>-ie,moH%df`LL3ҾL?83G0_ %}_+/ļVk/}-|r"UmfnZvz[Yr^_?D,F!.rV8/_z7)mW5jUFtE6ʩC_sE)Փ9/RZ؝%nK-ZBhM]=Caګ_n]d} 6rRszB{ġHc ~Sd~ ,y`}a/݇ggUoli8%\UKTOƾ]@XeHA]Vɪ]Y_us+';8))J@u4J迁>aLP/Iy9cS74h4or @Sc>(ii"K=^@>>GngD!z7;T4Ap˃ t-$ECڅh)~Gv(3رjreܭD+TDɴ1`ɵŊ뜄o^ZKw$MI>b?46s4ی=Eiyj2Ѵ(AJoHfM/;C#C] ,sm;?x{ yKo-cg6 e>&NP:ʝ]\dJ.J>;jU: 3֠c䬥vYUꢙ! 1ȵ"+UƘuѩhM9UOD'e0w1f-_ Wx\_0Oa::u^cĿ:ռo35Q.X]do"6lzi ?A-ijm Z~+hѫZBrjw㻭f_0P+V"1xIduk݃s:QAm-j@f%ƭ6v5+h;Mc6J`mR{?ikMccMZ}T5ձCjOHk+\db*]n1ktkv-Im|;bk9_&voy1uސَ7bn!M7IfEY7%(ۼNJU1T)[F1}C'6&Ə`b|%j(B+Bb#Hm#ƷHU1Do!|^Bz'b@a~Gxaxsau:or>z0>8an׆05!ah 5;Fx0>/ 3"f&6+ߊ(m1*B/f&0('B0&\0%/Ћ#!0^!? 0z=8xm0xg0~Gxa0sx[0WOxR0>B ڼYfEo`,;0л>h` /!k+G`<>@_yn| o<z0zxc?oc?O Uc?oEn?C[J?6ҍe~c?Ə~c?ώa퇖 c g[Ɗo,Zo,*~h97COƲiZ7vM]o{RQoEzc؟-3WCk3ʹ1vF(BvjQ΃E,3' *^F.UBjrIInVQCSw襣_?K^'EFj[Ug8u /?L ۩M}b+OZ]ڣIs?/C+g0c7CB[ԄyŢ]q4Ez9C;)Rԙ>F?KGƳOߍ\=>dd,D>m7QJA׻Rx7*) hiʎf[]+A9=!Kɵ\?1>%0:\&)rɨ9kd~#1;ߧp^:w _~yhxi 7smH3=O t/E>EAnvhݯui$_ Κ|)>ednLj3Ҽ>h~]Eۭoހ,PeecoK,dhHލۼg;q3wM'/!Ж%'v|!߉q7|C6"߅d|l>B/Y^B;U%{Yhv` =cGFb:|G~;ZM-r0͠罄4wyi0ߣݣh7d&jE>Q:`^bl5}yfF#yl-fJ!|ےY_yO1#~ΏibMTЮERCmjnu(;J.z ,*I8f=feWXk}5=YgtY4|Ss#2_(mmȘ '?84掟CO mo?;K"/Qsb/K8|Èit2o^AS:a K["wށG,⛠e@19ڬGqt>{G(fǎП mgGEcsN4.u_ٟFc]=ᛲÎd7l3+hK["GCK4k͡/!#CFٓ]o0.ςWм|"]$Vޤ1釤)瘦 g^гN"܃kvVGԍzʓEMh<)ykaڌڏ.p*RٓfFͷr"u"%k*]c3eDm| hD[w{8sf3s&jfocYKZqep!4&x|]{'{}ǫ~Xw߄.Oi99H1sr RMLS\KHy>+b"?=;ҿsпɍDe+YWI;[w{J[l&R֠D'^oKw@LR&3-#Ӻ7~ݥd?gMetuǖz:F 'h?. K[ۦejOF~MMv~%zFg}-˩gY@^f6p_槖c cJȾhN_߁|пt}BӠ;stm\9[h#_Pr̰eN7utP=2HLX\ɕ?M}hzQsvDu9aH& U~=zȫ3o/gvӧ3lY)4WQ`?|@L3vVu9Fj+:3ד7ɼy{^[ 6V{Ygc+D')ٛ]=L}(ݭnp9~:x=z'hY)9au}[x~쌛Q]co1ck KkMAsb_ qAsךgrY⊠V.06VipjxWL">^1W@kTmծ,rv.AK  NZtj!,6/KT\Mg]Zpd0^perT5X-uNϖtp,vWW& vέػ]< N00M>&iI>6HtoZʒP%R1եɍB  %/}QpDxR0,yZIoF&/JQтtZK%K4JR1T@ΑpAxU(ԚzjV&ۙ#a`9iٚ#\OPӹM%  z,&.c$~Lz|OIOKð|0eHLEڹ6?u^t#z LqZ.Rժr? u}VZv.xO J ^xcQyTLLW,rn I&m?I/J9W̫.͛"׾^gJ P']-X"6n>: m>&d=3*=-ZI$^'\G:K5cO1ԥB  /J mO%Ryr }7RV-|z=ZP:-t$n)ҫKT`Fzsj %EߘZ/|)UIovf\ 7 rO-2CxRBw]̌& fg2cE7; k|4X(bJ^-X'ߒF# c\ !ed Iy'+3*33mߘBWgPӰ2OPPY(}*W TT& a 7'&WVHΌ̑~^9pvNHuWr`r 0Bivs}cy(o}&ASvF-t;{* ag |+v***_]Ы*7u`@સ`@reU X5\1' ƇHk|j6%ƧbUetjթ5A?E0>Dp=-uFv^NV:=JzSC_T5>iyzmU \5Se /""q!U3>ӮYUs K+k6Tm,,,U۫vUW:ZuUpB媫`;˰zi -ǣ=J{5 pʯ AVe/p6,S{o-s|]w <+Zأzn_&5sy C,, a߽ yg}7(g]'S-7v{Q[``w뽝7A:,8[x~쌛I?[kؽvۣL{^gow }Ѿ8N r|'t:ZΙ48˜Uzgp:se=t EEFEG&GGfEGGVDD6FFvFFEGNG.Dqq7pǸܩLw]6nqOgK͏FEGKh}t^tQtytutC)#==mEX%Pkz~wz" ޛ6[ & a^t^?ɛ(?Jx%~7R$(z^ۼ"Ďʼ7\h-JX䞪{j´&I&_/l?X/lvP|)ZjPX_m˅-WBau25z$l ?cp? ;a4T[aҗ>tzƞt3ٓQ#Ò1*٘I74Tr=}c2K1%]OqeIt)6DB͞I:taK:)}UN0F`-Դg-y&ۺ}*/6FW)'56<2~^[mKW[[wy+69>v h׷vx s0v!a&`;GyS;kگss Ov/)PW\/exuj$F1/A\$ϚIJYKiI'ҧ, t!L,dC z2pa0sdnl16|R g Y{k71ҍ==X7]ƻXw=Xz ll1i\k\_3Ʋofwwln{l h`rؠ(vW5lHxPxGȆF?>-!>+&|1+Yf9+jJVhl kRxi9-we3agRo%Y0;Ns2j8bÖlsI\ ĈY\n7!V,AXqKU\9B츇r!~]npu|3}5|H7X}J|b }%~+C%R +Vvƃr([_'^_ H/䳃}ad`z' zJ/񥃴SHOo'lgP n:]7Rv&j[I ! L)_-̯S~;7Q~9B#YIrɝ(;U+Hǫt-(彩.=D]w9*j|x-k>CJ> W3/2 冱\e|GxJL4g:cz7wA{+4v$a]g\60>!;!;x=pA2Mo>r )quaBRĥtO>jĹ9 lXO8y'NDJtXMHb:KDc9Kcwh,q0~ b~=࿜.M'XCVwe7  RX+f `gg8=QaS.E&\OHoK "y[*5`$ؼ68^xȄspqK1KC*ա5*)%+pPZem>い $F$(sgXs)Ḧ́e*ҙP5U,mp QRoЄJ(- }`.ѺX`fӘ#pn: _Ɲ˘Cg\ n;{zԙ=O_?S ~1y=0NS!y!l cJ_' DJ 4&(3-uc?1=8X&氵=j \ o]CxK.)B+L 91Xt=ߎ(UIz$R\Unyh|$fDž'!P+#B$rs~ 1 _3jGIMҮ6HD-sʢ\׵R&+ӕ] s׵=@P6HEmk;SVnr4kR6fjF> Hݠlr Pl"B*j߻CjeWAY;ԅ\WwH],s9rk@Yj^Cj2yyF2 sVY mLwwWJQ+d;Cj2޹A)FL'D/J\\W+H;\ecwCb$ϩ Hug1V:s ؃H+gu yS4m"iŤ8#33/vi+I+!JFi-}&Y}:O#f73{4+>6. ܛuw]Y[QRֺXV{ 4 k5=5 oTKQR[X,@ vlwlR#Hr[V[VR#HIsU[-e -(5k@#Wπf)H͒kj@wZ:-5wYsh!E xx99\U |\uHH:xgyyk'5t̥R|g&52)N|͜)]~9t:R4r͜-R#-2@4zY Eu,3}S h!䴛h4~iڤe@3mulRRF` 5 e#44ùk-jAJciisi8jA\S)Y`rCM#Xv?4&դ:*Qj)[LΞSc#JNGE8SjjQj)vGVI'dI4AmJZT%LvLڨp@ϑ8@FRDM #Qrtj)ÑC@ʀFr_۾zƲZ/PNTs`I9:C at%I ;8ྴxy<\D.S`%ς̖g3Q~T~`|<rE>><ڂ{6ӳPv,r9?TR\X ?YlbD5xx1Mp^&_qM}ݷ׶Ͷ hm툭 IUۮnڪf>:4Z-@h4d5:5:-{t&SdSratڊ֒ĚIF)5HdYk!9YL$k+%KEj/u`mRsH]%2Ytb~,NʑX],7g=rK[[>A`me3C6+e;$ .9Qr|)wrw+38|7ଂь<%#ƭ?Rgem}c-*N΄c|"R*[+ZwZX+ǬZQ kMb a36E g "$X#(.ቻ$KIR RT,u:,u1.P#ԗKX4R$9TeF܊˒,,6E2 ?){e/$fɩ,w;2&1.wcrO'sȽL攇07=Gq( E(a,g7pgqg[V|<1w|胦ܴ{9a6@8;lsh`Q`o.6O5/myy5υt  6.>~!s4RjUh oByТYEoΰM 5$L Bt'*<ʒΜbItX/[d al 2|Ƃ8;Sjg5?WwzFǎ'%F;& jT(9{?yQNx?a)e(5( A5H5-Ah 2d5Jk ;AZi 5(ٵWoT-BFhRٰB ?>J\(/BBfs/91{[A|N԰:.!)v\F<ͽqA>#K.!pjOP;P͸tHBp߉Pp¯tI ~=c@m{~ku& A_FL-$ϒ|$w)4;SBAf㈛@h@)4z4R*P{Q:K& Zxv JF,v Qp^//_=| sVY>GKm,I;I"D.V `kQ֙XO}*րE8FM!a}Wa}$CI;N y$!ٙdfAs@8^UuWaVsI+IB"&x]UHx]H]k >4FXОG'Y#YkD8;@sVY# =̏j UA$X#>BT'FLJHA98Uړ$ ZweYNODҷQ="K4l P+pA _M:E$cHzNq  zAZD0 z XRB}RG=H6`rɒExXK'K{.dA'I"vN4h,aK4 hD ;*،5yE|2`K@C-icGi6 M߬ڣoA(\Bܻ=og=D_A T^~Iǽ Qjđ|3u B9XUsy_(fYͧ( "[$ܸZM"B@&;²ٿ!O>zp|j_b=ZԎb{VwwJ_D콏i!,axV.ԯ %aV BѪ.ѧ2ߕ `Խƻ\4]Yp73>u.>'\yhڣU5h`F? =* jxzx4,ѫ!7׵ŲXa|<; s4W0/8l.W>FK q' qP=S0λi%t%7x-5 spa JD*wH ֕[x (:hO]4NMqz-8~; b  j->~졈$zq&#N[-DPb ًЮ xC rA!z^Fwu! 3(X]R{>j4 NOBWvMWX9\AW\KfxQ g^ +hǿ;i Nu  3C8TՁu~g7uQS O#iB+=o=~|kL!Zg-iy OGe_ <DOIFNsLDDkN+tmѢOv'z`&R 0!0ʖ`Y~b QԆa:\Ǔ}s2W[F1xo q&;buD;?W.~&V[9Wa? AHRZߡ]D dهB,<>*G Qa~,Q GUsJ=XzIJO<Im:Ѳ8dD،Qc~~0a];w=Σ{G/(@Ų1" }9U؊{4c}8N;M_N181bq] sWѮe/#lHgQ*z}. r8}OG-𰹅d_X0Kg>Aת$YEv_=b:D_ۣ:r?C(VŜBgS\̣Φb .%΢`N\hV+m 5ܿ'ć^:j 3jZuuu&HiwD:vuBpR _۟\Cu B;'_6q>n wUDyw$ڡt{n»tW/,%E[p_7ʖE8L=l z șMcWgh%]\qwq>>= DHY zg#l~oLTFz} -ODpW#^?@ fN.뎾 =~D -_d3Z8ZvkYZL9A9oF X%Pl yRָQ^6L6@j9YEbʙ< t"C |5Et%[0}|\wGa#^/'Ν9P ;NsוzʏQD>%$rFW=fjnM r>D9Ds!Ճ{(A۔zޠsߏcF?B6Կ$L1ͣPJʶcAp4݆<o$Ȏ_ie pa)RY[cC:'{ ~0VGꞡsQj,+H@B9_k7h3mP#FϑbQM_|] xLhk^`z~;)5]Gv/2llgxU1뇾z P8t+pya(Չyq{q\iCnn "ePC'/ 8I؉RhUȓE(vݶBK /yQRٟ+)t_k X~ǖQOXQ.FB?i9ĺ&|.wh-⋿McuT6Sָ 舽ptz;: =ǯE8u0wxm0Ș<=oR hn"FKg_KQBw$x\:0ڶ>$R%w<ߍ9K5A~:'(9?!ٞj;>FZd9,H~B, ew ~ìD_oo_nY+F幃eh2kiwNr#=$Qĵvb@)|FL!CJ㖢;~y0K: E{v#T3}!ag,}dA!p_ȓM2Ww4pFVK9{tL(Z1-|f\V;Fgݫo9Ëj#w_nW5zͻϢ?;yεJ{N$4/-5aƧu[>jJQǮY{m?]ӏ?O.3T}`^r}a鶨$Mߐ7Ǎ90وO/_|N^{{=ԓK6EUdNN뜷m>;Nfv<폔޵/fN/(˪Ңvu_U`X5ѩfRsK1B4N>"خtͿmH[\bkCf(3_d\Lyϛ*J Vzguսz䗔wJL9;1#&&OIEYrbcħHF01u xmVʗ/0eʔ_IQsjP5$P|˄pD|2|oBof q}:_]?gEoN3ӷ|}oL}ʱϬC_6Y{&^Dz%'q7϶;~͈w2ի^.yγSGڟy=]֬(y/eAߑgUgxGRHb;_ZW󕯖&}zCXouLx G\Us}O7kWi/%vJ{}T-)Lz{-4[~+񣸶< _[//A汳qg7n̸#JFۺ=P_4i\ɃjKjv/dOs k E ޶'=~V՟Y%>gqTEU؄3{V?^~dc+\ky\^\c'o١ao.g~XQv;O7fCw愞pZw+o83͸Nk ,1c=wYYkJf/̹x:n,L͸qGƎ} /a7on̚[o|w~{nO{l5WV8 W/TM<ϯ:\#̭D_o_90uR3ZzrbeQN |SkFˇgi؃GZdVk.[ne]KlHWD_F0;T3ԞMa;]!usz~}vS:ܛޒjxஇ=,?1o]l=-];t̕m1.UT̓}kN~r?f+GO+N{kNM}Ǡ;~+L5WM`@syCF,}dPdO|Y}&5Jc(sw?_Śy}YV|t3٩`~=8'A;,s8o"*tm:x{[O ,Bz{ vgf'n0{Y1SGF7#nK2Z򮘔z?1Q5l OB216QVޞ~ਫAصpj8*_[ DE?_/ˏdgݣ=\d"=Oc1,fۻ1z9.}<h'6N[aɟp\` :X[*a75ЧQ ((YІ|?- | ;gU0SDyYHȞ#&R<{GFG=.ڏjr7ԟhNv]hш Z)i!5qua7';rs!/WXi!PsXXu`? 3P)|Y[7~DOLTz5]Vm3tOm fj~Vz0ihW.X6oF0~gD*aUqrj$%% N QVP*cTHj$eU<؏Aߢ*Q{^0,ϓkk05U9W0*P[`;o@)uX7޽Ƅ!vN>“Ǥ.vx\w̍7&<4rE #073Rc,×yْG!-lt,Whn O6'0HI/K>i7vДW:cSًߍļ$Uk5M%en NꘕnhHl)1ѰwOJMQK Mњ^s#آ/(7{rråc{KNzGWtI*7ku0Z%EgՎ_7=#nT#GXU]d*xELeɔADA2h5t*-̻UA%bܐKeS|q. d:J|^Ϩ1SsMHT V1ih 3h-b< WpSVчbÓ]c&xѹyទ'B1O.:ׅo'}щ򉺪{7i٩uٗz^{R̳-/2Wtŝ\&AN|$ |0VV$ }Bm#1;`ؤ|HWyw%/[]QK#LcM5 oAuDD@í  g_De< DQgLߦAdAyRH|`VJBCEfo B ꂳ/Pߣ؜kBGwsIg3υSؓ܉ K}?ꌳӨu-{9N`dn~HȬ~e[GaM /j tM[ B$gysO3}+א&Ri:>&$1o?s#sFr/>h _Lre ZlqC3͘_2onQ9PDɜ (Rx/?F]$S.TM%x3"y^ʺg7X6Tb.|6Bvt6Sc`1ZWײaDmN w7i tsݐ.QlZ1wFXd{sɅÐ˗$S VvIFg. zJ5"h!@`wذ^!'Hc_ߟZ-r?RqQ6_~+E5_EDzo܈ņ6_;"`h;Ϣs8Q c̶d ]ر5M6 !9V b{9; ֠:'xMӘU{&.W3,i.aT7 5P~@-Q@` N6? Q79V:,s ZR:xYw lf='+ψoA7ܩzz`f ]y޹핟K IjNpN :( )q$ds oDFc"ǵ՝O#Q1ܨd-?0= endstream endobj 96 0 obj <> stream Microsoft® Word 2016 w2brasil Microsoft® Word 20162017-10-09T10:38:04-03:002017-10-09T10:38:04-03:00 uuid:195449A9-9E4C-4E20-85D4-9661E9D878B9uuid:195449A9-9E4C-4E20-85D4-9661E9D878B9 endstream endobj 97 0 obj <> endobj 98 0 obj <] /Filter/FlateDecode/Length 281>> stream x5=/CqV*UR{P6C*b$".FH+ix׽/|rssٶljac\%%̊|L-DƁ,B[lYpbK/NUDTTђ&q̈TH4rΚY3YXE_ekgB:, A D CQA0㐆iIH$afaιRk_Gn߸XWO^*{_gQ=Do/8t>Q endstream endobj xref 0 99 0000000036 65535 f 0000000017 00000 n 0000000166 00000 n 0000000229 00000 n 0000000623 00000 n 0000003115 00000 n 0000012056 00000 n 0000023498 00000 n 0000023551 00000 n 0000023719 00000 n 0000023958 00000 n 0000024012 00000 n 0000024182 00000 n 0000024418 00000 n 0000024550 00000 n 0000024580 00000 n 0000024740 00000 n 0000024814 00000 n 0000025067 00000 n 0000025241 00000 n 0000025481 00000 n 0000032302 00000 n 0000034444 00000 n 0000034619 00000 n 0000034864 00000 n 0000035099 00000 n 0000035231 00000 n 0000035261 00000 n 0000035421 00000 n 0000035495 00000 n 0000035735 00000 n 0000070756 00000 n 0000071152 00000 n 0000073769 00000 n 0000073998 00000 n 0000123077 00000 n 0000000037 65535 f 0000000038 65535 f 0000000039 65535 f 0000000040 65535 f 0000000041 65535 f 0000000042 65535 f 0000000043 65535 f 0000000044 65535 f 0000000045 65535 f 0000000046 65535 f 0000000047 65535 f 0000000048 65535 f 0000000049 65535 f 0000000050 65535 f 0000000051 65535 f 0000000052 65535 f 0000000053 65535 f 0000000054 65535 f 0000000055 65535 f 0000000056 65535 f 0000000057 65535 f 0000000058 65535 f 0000000059 65535 f 0000000060 65535 f 0000000061 65535 f 0000000062 65535 f 0000000063 65535 f 0000000064 65535 f 0000000065 65535 f 0000000066 65535 f 0000000067 65535 f 0000000068 65535 f 0000000069 65535 f 0000000070 65535 f 0000000071 65535 f 0000000072 65535 f 0000000073 65535 f 0000000074 65535 f 0000000075 65535 f 0000000076 65535 f 0000000077 65535 f 0000000078 65535 f 0000000079 65535 f 0000000080 65535 f 0000000081 65535 f 0000000082 65535 f 0000000083 65535 f 0000000084 65535 f 0000000000 65535 f 0000124275 00000 n 0000124577 00000 n 0000311198 00000 n 0000311854 00000 n 0000312455 00000 n 0000312754 00000 n 0000384341 00000 n 0000384654 00000 n 0000385158 00000 n 0000385387 00000 n 0000385618 00000 n 0000530882 00000 n 0000534023 00000 n 0000534068 00000 n trailer <] >> startxref 534550 %%EOF xref 0 0 trailer <] /Prev 534550/XRefStm 534068>> startxref 536688 %%EOF